LOCUS       NR_075237                108 bp    rRNA    linear   BCT 02-FEB-2015
DEFINITION  Porphyromonas gingivalis ATCC 33277 strain ATCC 33277 5S ribosomal
            RNA, complete sequence.
ACCESSION   NR_075237
VERSION     NR_075237.1
DBLINK      Project: 188106
            BioProject: PRJNA188106
KEYWORDS    RefSeq.
SOURCE      Porphyromonas gingivalis ATCC 33277
  ORGANISM  Porphyromonas gingivalis ATCC 33277
            Bacteria; Pseudomonadati; Bacteroidota; Bacteroidia; Bacteroidales;
            Porphyromonadaceae; Porphyromonas.
REFERENCE   1
  AUTHORS   Naito,M., Hirakawa,H., Yamashita,A., Ohara,N., Shoji,M.,
            Yukitake,H., Nakayama,K., Toh,H., Yoshimura,F., Kuhara,S.,
            Hattori,M., Hayashi,T. and Nakayama,K.
  TITLE     Determination of the genome sequence of Porphyromonas gingivalis
            strain ATCC 33277 and genomic comparison with strain W83 revealed
            extensive genome rearrangements in P. gingivalis
  JOURNAL   DNA Res. 15 (4), 215-225 (2008)
   PUBMED   18524787
REFERENCE   2  (bases 1 to 108)
  CONSRTM   NCBI RefSeq Targeted Loci Project
  TITLE     Direct Submission
  JOURNAL   Submitted (14-FEB-2013) National Center for Biotechnology
            Information, NIH, Bethesda, MD 20894, USA
REFERENCE   3  (bases 1 to 108)
  AUTHORS   Hattori,M., Yamashita,A., Toh,H., Oshima,K. and Shiba,T.
  TITLE     Direct Submission
  JOURNAL   Submitted (10-APR-2007) Contact:Masahira Hattori University of
            Tokyo, Graduate School of Frontier Sciences; 5-1-5 Kashiwanoha,
            Kashiwa, Chiba 277-8562, Japan URL
            :http://www.cb.k.u-tokyo.ac.jp/hattorilab/
COMMENT     REVIEWED REFSEQ: This record has been curated by NCBI staff. The
            reference sequence is identical to AP009380:234597-234704.
            COMPLETENESS: full length.
FEATURES             Location/Qualifiers
     source          1..108
                     /organism="Porphyromonas gingivalis ATCC 33277"
                     /mol_type="rRNA"
                     /strain="ATCC 33277"
                     /type_material="type strain of Bacteroides gingivalis"
                     /db_xref="taxon:431947"
                     /note="type strain of Porphyromonas gingivalis ATCC 33277"
     rRNA            1..108
                     /product="5S ribosomal RNA"
ORIGIN      

tcaggtggttataacgttggggatccacctcttcccattccgaacagagaagttaagcccaacggtgccgatggtactgcgtcacagtgggagagtaggacgccgccg

//