ver.2
Home
|
Help
|
Advanced search
Previous release (v1)
2025-12-17 21:36:14, GGRNA.v2 : RefSeq release 232 (Sep, 2025)
LOCUS NR_039872 89 bp RNA linear PRI 19-SEP-2021
DEFINITION Homo sapiens microRNA 4721 (MIR4721), microRNA.
ACCESSION NR_039872
VERSION NR_039872.1
KEYWORDS RefSeq.
SOURCE Homo sapiens (human)
ORGANISM Homo sapiens
Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
Catarrhini; Hominidae; Homo.
REFERENCE 1 (bases 1 to 89)
AUTHORS Zhao M, Tang Z, Wang Y, Ding J, Guo Y and Gao T.
TITLE A direct negative feedback loop of miR-4721/FOXA1/Nanog promotes
nasopharyngeal cell stem cell enrichment and metastasis
JOURNAL J Transl Med 19 (1), 387 (2021)
PUBMED 34503528
REMARK GeneRIF: A direct negative feedback loop of miR-4721/FOXA1/Nanog
promotes nasopharyngeal cell stem cell enrichment and metastasis.
Publication Status: Online-Only
REFERENCE 2 (bases 1 to 89)
AUTHORS Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L,
Loman N, Jonsson G, Naya H, Hoglund M, Borg A and Rovira C.
TITLE Identification of new microRNAs in paired normal and tumor breast
tissue suggests a dual role for the ERBB2/Her2 gene
JOURNAL Cancer Res 71 (1), 78-86 (2011)
PUBMED 21199797
REFERENCE 3 (bases 1 to 89)
AUTHORS Griffiths-Jones S, Grocock RJ, van Dongen S, Bateman A and Enright
AJ.
TITLE miRBase: microRNA sequences, targets and gene nomenclature
JOURNAL Nucleic Acids Res 34 (Database issue), D140-D144 (2006)
PUBMED 16381832
COMMENT PROVISIONAL REFSEQ: This record is based on preliminary annotation
provided by NCBI staff in collaboration with miRBase. The reference
sequence was derived from AC133550.2.
Summary: microRNAs (miRNAs) are short (20-24 nt) non-coding RNAs
that are involved in post-transcriptional regulation of gene
expression in multicellular organisms by affecting both the
stability and translation of mRNAs. miRNAs are transcribed by RNA
polymerase II as part of capped and polyadenylated primary
transcripts (pri-miRNAs) that can be either protein-coding or
non-coding. The primary transcript is cleaved by the Drosha
ribonuclease III enzyme to produce an approximately 70-nt stem-loop
precursor miRNA (pre-miRNA), which is further cleaved by the
cytoplasmic Dicer ribonuclease to generate the mature miRNA and
antisense miRNA star (miRNA*) products. The mature miRNA is
incorporated into a RNA-induced silencing complex (RISC), which
recognizes target mRNAs through imperfect base pairing with the
miRNA and most commonly results in translational inhibition or
destabilization of the target mRNA. The RefSeq represents the
predicted microRNA stem-loop. [provided by RefSeq, Sep 2009].
Sequence Note: This record represents a predicted microRNA
stem-loop as defined by miRBase. Some sequence at the 5' and 3'
ends may not be included in the intermediate precursor miRNA
produced by Drosha cleavage.
PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP
1-89 AC133550.2 43835-43923
FEATURES Location/Qualifiers
source 1..89
/organism="Homo sapiens"
/mol_type="transcribed RNA"
/db_xref="taxon:9606"
/chromosome="16"
/map="16p11.2"
gene 1..89
/gene="MIR4721"
/note="microRNA 4721"
/db_xref="GeneID:100616256"
/db_xref="HGNC:HGNC:41609"
/db_xref="miRBase:MI0017356"
precursor_RNA 1..89
/gene="MIR4721"
/product="microRNA 4721"
/db_xref="GeneID:100616256"
/db_xref="HGNC:HGNC:41609"
/db_xref="miRBase:MI0017356"
exon 1..89
/gene="MIR4721"
/inference="alignment:Splign:2.1.0"
variation 1
/gene="MIR4721"
/replace="a"
/replace="g"
/db_xref="dbSNP:2544829553"
variation 2
/gene="MIR4721"
/replace="a"
/replace="g"
/db_xref="dbSNP:1341977800"
variation 3
/gene="MIR4721"
/replace="a"
/replace="g"
/db_xref="dbSNP:2544829545"
variation 4
/gene="MIR4721"
/replace="c"
/replace="g"
/db_xref="dbSNP:2544829542"
variation 5
/gene="MIR4721"
/replace="c"
/replace="g"
/db_xref="dbSNP:1961865858"
variation 6
/gene="MIR4721"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:760049967"
variation 7
/gene="MIR4721"
/replace="c"
/replace="g"
/db_xref="dbSNP:1460882262"
variation 8
/gene="MIR4721"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:2544829530"
variation 9
/gene="MIR4721"
/replace="g"
/replace="t"
/db_xref="dbSNP:1395175547"
variation 10
/gene="MIR4721"
/replace="c"
/replace="t"
/db_xref="dbSNP:2544829526"
variation 11
/gene="MIR4721"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:775054744"
variation 12
/gene="MIR4721"
/replace="c"
/replace="t"
/db_xref="dbSNP:1961865479"
variation 14
/gene="MIR4721"
/replace="a"
/replace="g"
/db_xref="dbSNP:1961865409"
variation 15
/gene="MIR4721"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:1338038515"
variation 17
/gene="MIR4721"
/replace="a"
/replace="g"
/db_xref="dbSNP:2544829515"
variation 18
/gene="MIR4721"
/replace="a"
/replace="c"
/db_xref="dbSNP:2544829514"
variation 19
/gene="MIR4721"
/replace="a"
/replace="g"
/db_xref="dbSNP:2544829512"
variation 22
/gene="MIR4721"
/replace="a"
/replace="g"
/db_xref="dbSNP:1961865274"
variation 24
/gene="MIR4721"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:879136759"
variation 27
/gene="MIR4721"
/replace="c"
/replace="g"
/db_xref="dbSNP:2544829502"
variation 28
/gene="MIR4721"
/replace="c"
/replace="t"
/db_xref="dbSNP:1961865156"
variation 29
/gene="MIR4721"
/replace="a"
/replace="g"
/db_xref="dbSNP:767003495"
variation 31
/gene="MIR4721"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1961864945"
variation 32
/gene="MIR4721"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:140375296"
variation 33
/gene="MIR4721"
/replace="a"
/replace="g"
/db_xref="dbSNP:774039518"
variation 37
/gene="MIR4721"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1450884426"
variation 39
/gene="MIR4721"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:771236414"
variation 43
/gene="MIR4721"
/replace="a"
/replace="g"
/db_xref="dbSNP:756548108"
variation 46
/gene="MIR4721"
/replace="a"
/replace="g"
/db_xref="dbSNP:1279424445"
variation 50
/gene="MIR4721"
/replace="g"
/replace="t"
/db_xref="dbSNP:2544829470"
variation 52
/gene="MIR4721"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1961864487"
variation 53
/gene="MIR4721"
/replace="g"
/replace="t"
/db_xref="dbSNP:1961864439"
variation 55
/gene="MIR4721"
/replace="c"
/replace="t"
/db_xref="dbSNP:749683561"
variation 56
/gene="MIR4721"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:2544829457"
ncRNA 60..81
/ncRNA_class="miRNA"
/gene="MIR4721"
/product="hsa-miR-4721"
/db_xref="miRBase:MIMAT0019835"
/db_xref="GeneID:100616256"
/db_xref="HGNC:HGNC:41609"
/db_xref="miRBase:MI0017356"
variation 61..63
/gene="MIR4721"
/replace="g"
/replace="gag"
/db_xref="dbSNP:1468516587"
variation 63
/gene="MIR4721"
/replace="a"
/replace="g"
/db_xref="dbSNP:1961864256"
variation 65
/gene="MIR4721"
/replace="c"
/replace="g"
/db_xref="dbSNP:1441852546"
variation 66
/gene="MIR4721"
/replace="c"
/replace="g"
/db_xref="dbSNP:2544829449"
variation 67
/gene="MIR4721"
/replace="a"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:568012742"
variation 68
/gene="MIR4721"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1224416950"
variation 69
/gene="MIR4721"
/replace="c"
/replace="t"
/db_xref="dbSNP:770346107"
variation 70
/gene="MIR4721"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:748657714"
variation 72
/gene="MIR4721"
/replace="c"
/replace="g"
/db_xref="dbSNP:781324296"
variation 76
/gene="MIR4721"
/replace="c"
/replace="t"
/db_xref="dbSNP:372032229"
variation 77
/gene="MIR4721"
/replace="a"
/replace="g"
/db_xref="dbSNP:548287959"
variation 78
/gene="MIR4721"
/replace="a"
/replace="g"
/db_xref="dbSNP:2544829435"
variation 79
/gene="MIR4721"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:780459003"
variation 81
/gene="MIR4721"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1392691829"
variation 82
/gene="MIR4721"
/replace="a"
/replace="g"
/db_xref="dbSNP:367961753"
variation 83
/gene="MIR4721"
/replace="c"
/replace="t"
/db_xref="dbSNP:753683624"
variation 85
/gene="MIR4721"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:2544829420"
variation 86
/gene="MIR4721"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1961862813"
variation 87
/gene="MIR4721"
/replace="a"
/replace="g"
/db_xref="dbSNP:2544829417"
variation 88
/gene="MIR4721"
/replace="c"
/replace="t"
/db_xref="dbSNP:777489248"
variation 89
/gene="MIR4721"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:756076573"
ORIGIN
gggcctggtcatggtcaagccaggttccatcaagccccaccagaaggtggaggcccaggtgagggctccaggtgacggtgggcagggtt
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]