2025-07-03 11:29:07, GGRNA.v2 : RefSeq release 229 (Mar, 2025)
LOCUS NR_031761 3599 bp RNA linear ROD 06-AUG-2023 DEFINITION Mus musculus RecQ mediated genome instability 1 (Rmi1), transcript variant 3, non-coding RNA. ACCESSION NR_031761 VERSION NR_031761.1 KEYWORDS RefSeq. SOURCE Mus musculus (house mouse) ORGANISM Mus musculus Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha; Muroidea; Muridae; Murinae; Mus; Mus. REFERENCE 1 (bases 1 to 3599) AUTHORS Guiraldelli MF, Eyster C and Pezza RJ. TITLE Genome instability and embryonic developmental defects in RMI1 deficient mice JOURNAL DNA Repair (Amst) 12 (10), 835-843 (2013) PUBMED 23900276 REMARK GeneRIF: results demonstrate the importance of RMI1 in maintaining genome integrity and normal embryonic development REFERENCE 2 (bases 1 to 3599) AUTHORS Xue X, Raynard S, Busygina V, Singh AK and Sung P. TITLE Role of replication protein A in double holliday junction dissolution mediated by the BLM-Topo IIIalpha-RMI1-RMI2 protein complex JOURNAL J Biol Chem 288 (20), 14221-14227 (2013) PUBMED 23543748 REFERENCE 3 (bases 1 to 3599) AUTHORS Suwa A, Yoshino M, Kurama T, Shimokawa T and Aramori I. TITLE Glucose regulates RMI1 expression through the E2F pathways in adipose cells JOURNAL Endocrine 40 (1), 56-61 (2011) PUBMED 21432623 REMARK GeneRIF: Glucose regulates RMI1 expression through the E2F pathways in adipose cells. REFERENCE 4 (bases 1 to 3599) AUTHORS Chen H, You MJ, Jiang Y, Wang W and Li L. TITLE RMI1 attenuates tumor development and is essential for early embryonic survival JOURNAL Mol Carcinog 50 (2), 80-88 (2011) PUBMED 21229605 REMARK GeneRIF: These results demonstrated a dual-role of RMI1 in embryonic development and tumor suppression. REFERENCE 5 (bases 1 to 3599) AUTHORS Suwa A, Yoshino M, Yamazaki C, Naitou M, Fujikawa R, Matsumoto S, Kurama T, Shimokawa T and Aramori I. TITLE RMI1 deficiency in mice protects from diet and genetic-induced obesity JOURNAL FEBS J 277 (3), 677-686 (2010) PUBMED 20050919 REMARK GeneRIF: results suggest that the regulation of energy balance by RMI1 is attributable to the regulation of food intake and E2F8 expression in adipose tissue. REFERENCE 6 (bases 1 to 3599) AUTHORS Araki K, Imaizumi T, Sekimoto T, Yoshinobu K, Yoshimuta J, Akizuki M, Miura K, Araki M and Yamamura K. TITLE Exchangeable gene trap using the Cre/mutated lox system JOURNAL Cell Mol Biol (Noisy-le-grand) 45 (5), 737-750 (1999) PUBMED 10512203 COMMENT VALIDATED REFSEQ: This record has undergone validation or preliminary review. The reference sequence was derived from AC154437.2 and AK079457.1. Transcript Variant: This variant (3) has an alternate 5' exon, compared to variant 1. This variant is represented as non-coding due to the presence of an upstream ORF that is predicted to interfere with translation of the longest ORF; translation of the upstream ORF renders the transcript a candidate for nonsense-mediated mRNA decay (NMD). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. ##Evidence-Data-START## Transcript exon combination :: AK079457.1, AK139703.1 [ECO:0000332] RNAseq introns :: single sample supports all introns SAMN00849374, SAMN00849375 [ECO:0000348] ##Evidence-Data-END## COMPLETENESS: full length. PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP 1-20 AC154437.2 143461-143480 21-608 AK079457.1 9-596 609-2759 AC154437.2 149372-151522 2760-3594 AK079457.1 2748-3582 3595-3599 AC154437.2 152358-152362 FEATURES Location/Qualifiers source 1..3599 /organism="Mus musculus" /mol_type="transcribed RNA" /strain="C57BL/6" /db_xref="taxon:10090" /chromosome="13" /map="13 31.05 cM" gene 1..3599 /gene="Rmi1" /gene_synonym="4932432N11Rik" /note="RecQ mediated genome instability 1" /db_xref="GeneID:74386" /db_xref="MGI:MGI:1921636" misc_RNA 1..3599 /gene="Rmi1" /gene_synonym="4932432N11Rik" /product="RecQ mediated genome instability 1, transcript variant 3" /db_xref="GeneID:74386" /db_xref="MGI:MGI:1921636" exon 1..270 /gene="Rmi1" /gene_synonym="4932432N11Rik" /inference="alignment:Splign:2.1.0" misc_feature 59..298 /gene="Rmi1" /gene_synonym="4932432N11Rik" /inference="COORDINATES: ab initio prediction:ORF Finder" /note="long (>35aa) upstream ORF has strong Kozak sequence; nonsense-mediated decay (NMD) candidate" exon 271..359 /gene="Rmi1" /gene_synonym="4932432N11Rik" /inference="alignment:Splign:2.1.0" exon 360..3599 /gene="Rmi1" /gene_synonym="4932432N11Rik" /inference="alignment:Splign:2.1.0" misc_feature 389..2239 /gene="Rmi1" /gene_synonym="4932432N11Rik" /inference="COORDINATES: alignment:Blast2seq::RefSeq|NM_001168248.2" /note="primary ORF" ORIGIN
gccttccgccggcgactccctttgggctggaaggccgcgggcctgagaaaactcgggcatggggatagcccaagccgccatcccggggcgccaacccgctccggggactcgctaccccgaagccctagcccacccagatacctacaggccgcaatcgagtgggagacgagcacgacggcgacgtccgtgcagcggagaagcagaggataatggcgtctgcagcgctgtcgcctgtagcgccctcctcctttctcgttcgcgcactctgtgggtcatttctctgcagaggaggctctgagtactgtactgaccatctagcttgaaatccctcgttagctcacaggctggcctgctaagtggtagatgtggatcctcttacttaaaagaaatgagtgtagctagtgctgtattaagagttgaaacctggcttttggcaacatggcatgttaaggtacctccaatgtggctggaagcttgtgttaactggatccaagaagaaaataataatgctactttgagtcaggcacaaataaataaacaagtgttggagcaatggcttcttactgacctgagagacttggaacatcctctcttacctgatgacattttagaactgccaaagggagaactgaatgggttttatgctctacagatcaattctttggttgatgtgagtcagcctgcttattcacagatacagaagctgagaggaaagaatacaaccaatgatctcgtctcagctgaaacgcagagtactccaaaaccatgggaagtgaggccttctcggatgctgatgctacagctcactgatggtgtcacacacattcagggaatggagtatcagtctatcccagctctccatagtggtcttcctccaggtacaaaaattttagttcgtggatgcattttgttccgtcttggtgttctcttactgaaaccagaaaatgtgaaggtgctagggggtgaggtagatggtctttcagaagaaaatgcccaagaaaaagtacttgcaagattaattggggaacttgatcctacagttccagtcattccaaataattccattcacaacgtgcccaaagtttcagggggcttagatgctgttttggggccctcggatgaagaactcttggcaagtcttgatgaaagtgaagagtctgcagcaaataatgacgtggctatggaaagaagctgtttcagcacaggcacttcctcaaatactactccgacaaatccgtctggttttgagccaggatgtaacatttcttcaaggccaaaggagaaaccaccaaaccagcccacgcatttcactgatggagaatttgatgacttttcactggaagaggccttgcttttggaagagactgtccagaaagaacagatggaaacaaaagcatcgcagccactaactttgaaggaaaacactggtaaatgtatggagattttttcacataaacctagtagtctgaaccacacagctttgattcataaacaaggaaacagcaattttgatgaaaaaacatctgaacaaatgattcatgaagacaaattttttgattgtgcatctactagaaaccatcataagagattctcagctcatgattttacaaatgacagtaagatttcagaagtagatgatgcagcacaacagaccctcagcagttcaaatgtacattgcttacgtaataaaatattaaacagaaagctggacctatcagaaaagagttcacaaatttctaaagaaaatggccaccctttccaggcttgttcttcaagatcatttgagaataatacttatctatctattggcatggacttacattctccaccctttatctatttgtctgttctaatggccagaaagccaaaggaagttactactgtgacagtcaaagcgtttattgtcactttaactggaaatctctcaagttctggtggcttttggggtgtaactgcaaaagtttctgatggtactgcatatctagatgtagattttatagacgaaatacttaccagtatgatagggtattcagtaccagaaatgaaacaattaagaaaggaccctcttaaatataaaacattcctagaagggttacagaaatgtcagcgagatctgatcgatttgtgttgcctgatgactatttcatacgatccttcttcatgtaaaggggtggtgctggaattgcaagatgttggtatggaacacgtggagaacctaaagaaacggttgaataaataatttgccagaatgctattggagcacactttaaaacaggcaaatatttggaatcaaatttgtgtattctcagttttggaattctgtaagaaaaagcttcagagcttaaagctggggcagctccgcggttgacagacacagtgtctgccaagtgtggtaactggagtttaaccatctggtctctcgaggcaaaaggcgagaccctgcttccagaatccgttggtagtcctctacacaggtggcagaggacacacacacacacacacgtactaaataaatgacatttaaaaataaagatatttaatcaaaatatgtgaaagaatgtttatattttggtgatactggcccagagtcttgtaatgctagcaagtttctaccatagttacatctctagatccttgggatgtttgtttgttttgtttatttttttgttttccctccctggaaactggatctcatacacaggctgtcctcaaactctcttgtatagctgagagtgacctcgagtttctggtctcttgccttcaccacccaagtgctagatttagggttgtacatttttacctgtgcgtgctaggcaaatgctctaccaactgagccatatccccagtccttgttgaagggtttagctgacccactctggctgagaaacttgttttccacttgtcattggataaacctaaaattgataaagaatagtgatggactgacagcagtttgttgggtaaaggtgcttgctgctgagcctgacaacctgatgctattcctggtaccacatgctggaaagcgaaaactctcccacaagatggcctctgatttccacctgcatgccaaaacgtgtgtgctccctcccatacataaaggtacacacaatgaaataaaatttaataaagagttgatgttccccagtgagatattactgaaagttaggaattgaaaattagtaattttacctctaataagttgaatattaaaaaaaattgtactgtgatttagatatcttccatttactgtgtgtataggtcagagggcagcctgggacacttggctttctcctgctgtgtggattcatggggtaaaatcctcaggctctgcacgcaccttgtacctgctgagctgtgaggatggctctggcttttgagatagtatcctgatacgtttccaggatcctgcgaattggctttgcatatgagttatttgtgttattgttttaaagagactagactatttccttttgctgtactagattatgtttgggagatgtacttttaaaattgtaaaagtgtgtgtgtgtgtagagattgatgaatggaatgaacctctgaacctgtaagccatccccaattaaatgtccttagaagag
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]