ver.2
Home
|
Help
|
Advanced search
Previous release (v1)
2025-12-24 11:31:35, GGRNA.v2 : RefSeq release 232 (Sep, 2025)
LOCUS NR_031761 3599 bp RNA linear ROD 06-AUG-2023
DEFINITION Mus musculus RecQ mediated genome instability 1 (Rmi1), transcript
variant 3, non-coding RNA.
ACCESSION NR_031761
VERSION NR_031761.1
KEYWORDS RefSeq.
SOURCE Mus musculus (house mouse)
ORGANISM Mus musculus
Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha;
Muroidea; Muridae; Murinae; Mus; Mus.
REFERENCE 1 (bases 1 to 3599)
AUTHORS Guiraldelli MF, Eyster C and Pezza RJ.
TITLE Genome instability and embryonic developmental defects in RMI1
deficient mice
JOURNAL DNA Repair (Amst) 12 (10), 835-843 (2013)
PUBMED 23900276
REMARK GeneRIF: results demonstrate the importance of RMI1 in maintaining
genome integrity and normal embryonic development
REFERENCE 2 (bases 1 to 3599)
AUTHORS Xue X, Raynard S, Busygina V, Singh AK and Sung P.
TITLE Role of replication protein A in double holliday junction
dissolution mediated by the BLM-Topo IIIalpha-RMI1-RMI2 protein
complex
JOURNAL J Biol Chem 288 (20), 14221-14227 (2013)
PUBMED 23543748
REFERENCE 3 (bases 1 to 3599)
AUTHORS Suwa A, Yoshino M, Kurama T, Shimokawa T and Aramori I.
TITLE Glucose regulates RMI1 expression through the E2F pathways in
adipose cells
JOURNAL Endocrine 40 (1), 56-61 (2011)
PUBMED 21432623
REMARK GeneRIF: Glucose regulates RMI1 expression through the E2F pathways
in adipose cells.
REFERENCE 4 (bases 1 to 3599)
AUTHORS Chen H, You MJ, Jiang Y, Wang W and Li L.
TITLE RMI1 attenuates tumor development and is essential for early
embryonic survival
JOURNAL Mol Carcinog 50 (2), 80-88 (2011)
PUBMED 21229605
REMARK GeneRIF: These results demonstrated a dual-role of RMI1 in
embryonic development and tumor suppression.
REFERENCE 5 (bases 1 to 3599)
AUTHORS Suwa A, Yoshino M, Yamazaki C, Naitou M, Fujikawa R, Matsumoto S,
Kurama T, Shimokawa T and Aramori I.
TITLE RMI1 deficiency in mice protects from diet and genetic-induced
obesity
JOURNAL FEBS J 277 (3), 677-686 (2010)
PUBMED 20050919
REMARK GeneRIF: results suggest that the regulation of energy balance by
RMI1 is attributable to the regulation of food intake and E2F8
expression in adipose tissue.
REFERENCE 6 (bases 1 to 3599)
AUTHORS Araki K, Imaizumi T, Sekimoto T, Yoshinobu K, Yoshimuta J, Akizuki
M, Miura K, Araki M and Yamamura K.
TITLE Exchangeable gene trap using the Cre/mutated lox system
JOURNAL Cell Mol Biol (Noisy-le-grand) 45 (5), 737-750 (1999)
PUBMED 10512203
COMMENT VALIDATED REFSEQ: This record has undergone validation or
preliminary review. The reference sequence was derived from
AC154437.2 and AK079457.1.
Transcript Variant: This variant (3) has an alternate 5' exon,
compared to variant 1. This variant is represented as non-coding
due to the presence of an upstream ORF that is predicted to
interfere with translation of the longest ORF; translation of the
upstream ORF renders the transcript a candidate for
nonsense-mediated mRNA decay (NMD).
Sequence Note: This RefSeq record was created from transcript and
genomic sequence data to make the sequence consistent with the
reference genome assembly. The genomic coordinates used for the
transcript record were based on transcript alignments.
##Evidence-Data-START##
Transcript exon combination :: AK079457.1, AK139703.1 [ECO:0000332]
RNAseq introns :: single sample supports all introns
SAMN00849374, SAMN00849375
[ECO:0000348]
##Evidence-Data-END##
COMPLETENESS: full length.
PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP
1-20 AC154437.2 143461-143480
21-608 AK079457.1 9-596
609-2759 AC154437.2 149372-151522
2760-3594 AK079457.1 2748-3582
3595-3599 AC154437.2 152358-152362
FEATURES Location/Qualifiers
source 1..3599
/organism="Mus musculus"
/mol_type="transcribed RNA"
/strain="C57BL/6"
/db_xref="taxon:10090"
/chromosome="13"
/map="13 31.05 cM"
gene 1..3599
/gene="Rmi1"
/gene_synonym="4932432N11Rik"
/note="RecQ mediated genome instability 1"
/db_xref="GeneID:74386"
/db_xref="MGI:MGI:1921636"
misc_RNA 1..3599
/gene="Rmi1"
/gene_synonym="4932432N11Rik"
/product="RecQ mediated genome instability 1, transcript
variant 3"
/db_xref="GeneID:74386"
/db_xref="MGI:MGI:1921636"
exon 1..270
/gene="Rmi1"
/gene_synonym="4932432N11Rik"
/inference="alignment:Splign:2.1.0"
misc_feature 59..298
/gene="Rmi1"
/gene_synonym="4932432N11Rik"
/inference="COORDINATES: ab initio prediction:ORF Finder"
/note="long (>35aa) upstream ORF has strong Kozak
sequence; nonsense-mediated decay (NMD) candidate"
exon 271..359
/gene="Rmi1"
/gene_synonym="4932432N11Rik"
/inference="alignment:Splign:2.1.0"
exon 360..3599
/gene="Rmi1"
/gene_synonym="4932432N11Rik"
/inference="alignment:Splign:2.1.0"
misc_feature 389..2239
/gene="Rmi1"
/gene_synonym="4932432N11Rik"
/inference="COORDINATES:
alignment:Blast2seq::RefSeq|NM_001168248.2"
/note="primary ORF"
ORIGIN
gccttccgccggcgactccctttgggctggaaggccgcgggcctgagaaaactcgggcatggggatagcccaagccgccatcccggggcgccaacccgctccggggactcgctaccccgaagccctagcccacccagatacctacaggccgcaatcgagtgggagacgagcacgacggcgacgtccgtgcagcggagaagcagaggataatggcgtctgcagcgctgtcgcctgtagcgccctcctcctttctcgttcgcgcactctgtgggtcatttctctgcagaggaggctctgagtactgtactgaccatctagcttgaaatccctcgttagctcacaggctggcctgctaagtggtagatgtggatcctcttacttaaaagaaatgagtgtagctagtgctgtattaagagttgaaacctggcttttggcaacatggcatgttaaggtacctccaatgtggctggaagcttgtgttaactggatccaagaagaaaataataatgctactttgagtcaggcacaaataaataaacaagtgttggagcaatggcttcttactgacctgagagacttggaacatcctctcttacctgatgacattttagaactgccaaagggagaactgaatgggttttatgctctacagatcaattctttggttgatgtgagtcagcctgcttattcacagatacagaagctgagaggaaagaatacaaccaatgatctcgtctcagctgaaacgcagagtactccaaaaccatgggaagtgaggccttctcggatgctgatgctacagctcactgatggtgtcacacacattcagggaatggagtatcagtctatcccagctctccatagtggtcttcctccaggtacaaaaattttagttcgtggatgcattttgttccgtcttggtgttctcttactgaaaccagaaaatgtgaaggtgctagggggtgaggtagatggtctttcagaagaaaatgcccaagaaaaagtacttgcaagattaattggggaacttgatcctacagttccagtcattccaaataattccattcacaacgtgcccaaagtttcagggggcttagatgctgttttggggccctcggatgaagaactcttggcaagtcttgatgaaagtgaagagtctgcagcaaataatgacgtggctatggaaagaagctgtttcagcacaggcacttcctcaaatactactccgacaaatccgtctggttttgagccaggatgtaacatttcttcaaggccaaaggagaaaccaccaaaccagcccacgcatttcactgatggagaatttgatgacttttcactggaagaggccttgcttttggaagagactgtccagaaagaacagatggaaacaaaagcatcgcagccactaactttgaaggaaaacactggtaaatgtatggagattttttcacataaacctagtagtctgaaccacacagctttgattcataaacaaggaaacagcaattttgatgaaaaaacatctgaacaaatgattcatgaagacaaattttttgattgtgcatctactagaaaccatcataagagattctcagctcatgattttacaaatgacagtaagatttcagaagtagatgatgcagcacaacagaccctcagcagttcaaatgtacattgcttacgtaataaaatattaaacagaaagctggacctatcagaaaagagttcacaaatttctaaagaaaatggccaccctttccaggcttgttcttcaagatcatttgagaataatacttatctatctattggcatggacttacattctccaccctttatctatttgtctgttctaatggccagaaagccaaaggaagttactactgtgacagtcaaagcgtttattgtcactttaactggaaatctctcaagttctggtggcttttggggtgtaactgcaaaagtttctgatggtactgcatatctagatgtagattttatagacgaaatacttaccagtatgatagggtattcagtaccagaaatgaaacaattaagaaaggaccctcttaaatataaaacattcctagaagggttacagaaatgtcagcgagatctgatcgatttgtgttgcctgatgactatttcatacgatccttcttcatgtaaaggggtggtgctggaattgcaagatgttggtatggaacacgtggagaacctaaagaaacggttgaataaataatttgccagaatgctattggagcacactttaaaacaggcaaatatttggaatcaaatttgtgtattctcagttttggaattctgtaagaaaaagcttcagagcttaaagctggggcagctccgcggttgacagacacagtgtctgccaagtgtggtaactggagtttaaccatctggtctctcgaggcaaaaggcgagaccctgcttccagaatccgttggtagtcctctacacaggtggcagaggacacacacacacacacacgtactaaataaatgacatttaaaaataaagatatttaatcaaaatatgtgaaagaatgtttatattttggtgatactggcccagagtcttgtaatgctagcaagtttctaccatagttacatctctagatccttgggatgtttgtttgttttgtttatttttttgttttccctccctggaaactggatctcatacacaggctgtcctcaaactctcttgtatagctgagagtgacctcgagtttctggtctcttgccttcaccacccaagtgctagatttagggttgtacatttttacctgtgcgtgctaggcaaatgctctaccaactgagccatatccccagtccttgttgaagggtttagctgacccactctggctgagaaacttgttttccacttgtcattggataaacctaaaattgataaagaatagtgatggactgacagcagtttgttgggtaaaggtgcttgctgctgagcctgacaacctgatgctattcctggtaccacatgctggaaagcgaaaactctcccacaagatggcctctgatttccacctgcatgccaaaacgtgtgtgctccctcccatacataaaggtacacacaatgaaataaaatttaataaagagttgatgttccccagtgagatattactgaaagttaggaattgaaaattagtaattttacctctaataagttgaatattaaaaaaaattgtactgtgatttagatatcttccatttactgtgtgtataggtcagagggcagcctgggacacttggctttctcctgctgtgtggattcatggggtaaaatcctcaggctctgcacgcaccttgtacctgctgagctgtgaggatggctctggcttttgagatagtatcctgatacgtttccaggatcctgcgaattggctttgcatatgagttatttgtgttattgttttaaagagactagactatttccttttgctgtactagattatgtttgggagatgtacttttaaaattgtaaaagtgtgtgtgtgtgtagagattgatgaatggaatgaacctctgaacctgtaagccatccccaattaaatgtccttagaagag
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]