ver.2
Home
|
Help
|
Advanced search
Previous release (v1)
2026-06-11 22:58:29, GGRNA.v2 : RefSeq release 233 (Jan, 2026)
LOCUS NR_030359 97 bp RNA linear PRI 30-APR-2024
DEFINITION Homo sapiens microRNA 630 (MIR630), microRNA.
ACCESSION NR_030359
VERSION NR_030359.1
KEYWORDS RefSeq.
SOURCE Homo sapiens (human)
ORGANISM Homo sapiens
Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
Catarrhini; Hominidae; Homo.
REFERENCE 1 (bases 1 to 97)
AUTHORS Cui,F., Sun,Z., Zhang,X. and Liu,C.
TITLE CircMAP3K4 Suppresses H2O2-Induced Human Lens Epithelial Cell
Injury by miR-630/ERCC6 Axis in Age-Related Cataract
JOURNAL Curr Eye Res 49 (5), 487-495 (2024)
PUBMED 38152055
REMARK GeneRIF: CircMAP3K4 Suppresses H2O2-Induced Human Lens Epithelial
Cell Injury by miR-630/ERCC6 Axis in Age-Related Cataract.
REFERENCE 2 (bases 1 to 97)
AUTHORS You,G.R., Cheng,A.J., Shen,E.Y., Fan,K.H., Huang,Y.F., Huang,Y.C.,
Chang,K.P. and Chang,J.T.
TITLE MiR-630 Promotes Radioresistance by Induction of Anti-Apoptotic
Effect via Nrf2-GPX2 Molecular Axis in Head-Neck Cancer
JOURNAL Cells 12 (24), 2853 (2023)
PUBMED 38132173
REMARK GeneRIF: MiR-630 Promotes Radioresistance by Induction of
Anti-Apoptotic Effect via Nrf2-GPX2 Molecular Axis in Head-Neck
Cancer.
Publication Status: Online-Only
REFERENCE 3 (bases 1 to 97)
AUTHORS Li,X., Jiang,X., Lu,J., Lin,Y., Jiang,L., Li,Y., Wan,F. and Wang,C.
TITLE CircCERS6 Suppresses the Development of Epithelial Ovarian Cancer
Through Mediating miR-630/RASSF8
JOURNAL Biochem Genet 60 (6), 2611-2629 (2022)
PUBMED 35676548
REMARK GeneRIF: CircCERS6 Suppresses the Development of Epithelial Ovarian
Cancer Through Mediating miR-630/RASSF8.
REFERENCE 4 (bases 1 to 97)
AUTHORS Gao,Q., Ren,Z., Jiao,S., Guo,J., Miao,X., Wang,J. and Liu,J.
TITLE HIF-3alpha-Induced miR-630 Expression Promotes Cancer Hallmarks in
Cervical Cancer Cells by Forming a Positive Feedback Loop
JOURNAL J Immunol Res 2022, 5262963 (2022)
PUBMED 36277475
REMARK GeneRIF: HIF-3alpha-Induced miR-630 Expression Promotes Cancer
Hallmarks in Cervical Cancer Cells by Forming a Positive Feedback
Loop.
Publication Status: Online-Only
REFERENCE 5 (bases 1 to 97)
AUTHORS Chu,W.K., Hung,L.M., Hou,C.W. and Chen,J.K.
TITLE MicroRNA 630 Represses NANOG Expression through Transcriptional and
Post-Transcriptional Regulation in Human Embryonal Carcinoma Cells
JOURNAL Int J Mol Sci 23 (1), 46 (2021)
PUBMED 35008480
REMARK GeneRIF: MicroRNA 630 Represses NANOG Expression through
Transcriptional and Post-Transcriptional Regulation in Human
Embryonal Carcinoma Cells.
Publication Status: Online-Only
REFERENCE 6 (bases 1 to 97)
AUTHORS Corcoran,C., Rani,S., Breslin,S., Gogarty,M., Ghobrial,I.M.,
Crown,J. and O'Driscoll,L.
TITLE miR-630 targets IGF1R to regulate response to HER-targeting drugs
and overall cancer cell progression in HER2 over-expressing breast
cancer
JOURNAL Mol Cancer 13, 71 (2014)
PUBMED 24655723
REMARK GeneRIF: our findings suggest miR-630 as a key regulator of cancer
cell progression in HER2 over-expressing breast cancer, through
targeting of IGF1R.
Publication Status: Online-Only
REFERENCE 7 (bases 1 to 97)
AUTHORS Chu,D., Zhao,Z., Li,Y., Li,J., Zheng,J., Wang,W., Zhao,Q. and Ji,G.
TITLE Increased microRNA-630 expression in gastric cancer is associated
with poor overall survival
JOURNAL PLoS One 9 (3), e90526 (2014)
PUBMED 24621930
REMARK GeneRIF: over-expression of miR-630 and its association with tumor
progression in human gastric cancer
Publication Status: Online-Only
REFERENCE 8 (bases 1 to 97)
AUTHORS Farhana,L., Dawson,M.I., Murshed,F., Das,J.K., Rishi,A.K. and
Fontana,J.A.
TITLE Upregulation of miR-150* and miR-630 induces apoptosis in
pancreatic cancer cells by targeting IGF-1R
JOURNAL PLoS One 8 (5), e61015 (2013)
PUBMED 23675407
REMARK GeneRIF: Upregulation of miR-150* and miR-630 induces apoptosis in
pancreatic cancer cells by targeting IGF-1R.
Publication Status: Online-Only
REFERENCE 9 (bases 1 to 97)
AUTHORS Cummins,J.M., He,Y., Leary,R.J., Pagliarini,R., Diaz,L.A. Jr.,
Sjoblom,T., Barad,O., Bentwich,Z., Szafranska,A.E., Labourier,E.,
Raymond,C.K., Roberts,B.S., Juhl,H., Kinzler,K.W., Vogelstein,B.
and Velculescu,V.E.
TITLE The colorectal microRNAome
JOURNAL Proc Natl Acad Sci U S A 103 (10), 3687-3692 (2006)
PUBMED 16505370
REFERENCE 10 (bases 1 to 97)
AUTHORS Griffiths-Jones,S., Grocock,R.J., van Dongen,S., Bateman,A. and
Enright,A.J.
TITLE miRBase: microRNA sequences, targets and gene nomenclature
JOURNAL Nucleic Acids Res 34 (Database issue), D140-D144 (2006)
PUBMED 16381832
COMMENT PROVISIONAL REFSEQ: This record is based on preliminary annotation
provided by NCBI staff in collaboration with miRBase. The reference
sequence was derived from AC100827.2.
Summary: microRNAs (miRNAs) are short (20-24 nt) non-coding RNAs
that are involved in post-transcriptional regulation of gene
expression in multicellular organisms by affecting both the
stability and translation of mRNAs. miRNAs are transcribed by RNA
polymerase II as part of capped and polyadenylated primary
transcripts (pri-miRNAs) that can be either protein-coding or
non-coding. The primary transcript is cleaved by the Drosha
ribonuclease III enzyme to produce an approximately 70-nt stem-loop
precursor miRNA (pre-miRNA), which is further cleaved by the
cytoplasmic Dicer ribonuclease to generate the mature miRNA and
antisense miRNA star (miRNA*) products. The mature miRNA is
incorporated into a RNA-induced silencing complex (RISC), which
recognizes target mRNAs through imperfect base pairing with the
miRNA and most commonly results in translational inhibition or
destabilization of the target mRNA. The RefSeq represents the
predicted microRNA stem-loop. [provided by RefSeq, Sep 2009].
Sequence Note: This record represents a predicted microRNA
stem-loop as defined by miRBase. Some sequence at the 5' and 3'
ends may not be included in the intermediate precursor miRNA
produced by Drosha cleavage.
Publication Note: This RefSeq record includes a subset of the
publications that are available for this gene. Please see the Gene
record to access additional publications.
PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP
1-97 AC100827.2 67632-67728 c
FEATURES Location/Qualifiers
source 1..97
/organism="Homo sapiens"
/mol_type="transcribed RNA"
/db_xref="taxon:9606"
/chromosome="15"
/map="15q24.1"
gene 1..97
/gene="MIR630"
/gene_synonym="hsa-mir-630; MIRN630"
/note="microRNA 630"
/db_xref="GeneID:693215"
/db_xref="HGNC:HGNC:32886"
/db_xref="miRBase:MI0003644"
precursor_RNA 1..97
/gene="MIR630"
/gene_synonym="hsa-mir-630; MIRN630"
/product="microRNA 630"
/db_xref="GeneID:693215"
/db_xref="HGNC:HGNC:32886"
/db_xref="miRBase:MI0003644"
exon 1..97
/gene="MIR630"
/gene_synonym="hsa-mir-630; MIRN630"
/inference="alignment:Splign:2.1.0"
variation 2
/gene="MIR630"
/gene_synonym="hsa-mir-630; MIRN630"
/replace="a"
/replace="g"
/db_xref="dbSNP:2542784535"
variation 4..5
/gene="MIR630"
/gene_synonym="hsa-mir-630; MIRN630"
/replace=""
/replace="tt"
/db_xref="dbSNP:750725925"
variation 7..9
/gene="MIR630"
/gene_synonym="hsa-mir-630; MIRN630"
/replace="a"
/replace="aca"
/db_xref="dbSNP:2064320865"
variation 8..13
/gene="MIR630"
/gene_synonym="hsa-mir-630; MIRN630"
/replace="cat"
/replace="catcat"
/db_xref="dbSNP:1310846413"
variation 8
/gene="MIR630"
/gene_synonym="hsa-mir-630; MIRN630"
/replace="c"
/replace="t"
/db_xref="dbSNP:1404480992"
variation 9
/gene="MIR630"
/gene_synonym="hsa-mir-630; MIRN630"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:775762051"
variation 10
/gene="MIR630"
/gene_synonym="hsa-mir-630; MIRN630"
/replace="a"
/replace="t"
/db_xref="dbSNP:1402253095"
variation 11
/gene="MIR630"
/gene_synonym="hsa-mir-630; MIRN630"
/replace="c"
/replace="t"
/db_xref="dbSNP:2064320935"
variation 12
/gene="MIR630"
/gene_synonym="hsa-mir-630; MIRN630"
/replace="a"
/replace="g"
/db_xref="dbSNP:1444076655"
variation 13
/gene="MIR630"
/gene_synonym="hsa-mir-630; MIRN630"
/replace="c"
/replace="t"
/db_xref="dbSNP:2064320964"
variation 14
/gene="MIR630"
/gene_synonym="hsa-mir-630; MIRN630"
/replace="a"
/replace="g"
/db_xref="dbSNP:2140443122"
variation 16
/gene="MIR630"
/gene_synonym="hsa-mir-630; MIRN630"
/replace="c"
/replace="t"
/db_xref="dbSNP:1308114046"
variation 17
/gene="MIR630"
/gene_synonym="hsa-mir-630; MIRN630"
/replace="a"
/replace="g"
/db_xref="dbSNP:749669360"
variation 18
/gene="MIR630"
/gene_synonym="hsa-mir-630; MIRN630"
/replace="c"
/replace="t"
/db_xref="dbSNP:1246367207"
variation 19
/gene="MIR630"
/gene_synonym="hsa-mir-630; MIRN630"
/replace="c"
/replace="t"
/db_xref="dbSNP:2064321022"
variation 27
/gene="MIR630"
/gene_synonym="hsa-mir-630; MIRN630"
/replace="a"
/replace="g"
/db_xref="dbSNP:2064321038"
variation 31
/gene="MIR630"
/gene_synonym="hsa-mir-630; MIRN630"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:769105916"
variation 33..36
/gene="MIR630"
/gene_synonym="hsa-mir-630; MIRN630"
/replace="ttt"
/replace="tttt"
/db_xref="dbSNP:1341482597"
variation 33
/gene="MIR630"
/gene_synonym="hsa-mir-630; MIRN630"
/replace="a"
/replace="t"
/db_xref="dbSNP:1356253254"
variation 34
/gene="MIR630"
/gene_synonym="hsa-mir-630; MIRN630"
/replace="c"
/replace="t"
/db_xref="dbSNP:1053789818"
variation 40
/gene="MIR630"
/gene_synonym="hsa-mir-630; MIRN630"
/replace="a"
/replace="g"
/db_xref="dbSNP:2064321101"
variation 41
/gene="MIR630"
/gene_synonym="hsa-mir-630; MIRN630"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1311959732"
variation 45..46
/gene="MIR630"
/gene_synonym="hsa-mir-630; MIRN630"
/replace="g"
/replace="gg"
/db_xref="dbSNP:758978114"
variation 46
/gene="MIR630"
/gene_synonym="hsa-mir-630; MIRN630"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:900622609"
variation 47
/gene="MIR630"
/gene_synonym="hsa-mir-630; MIRN630"
/replace="g"
/replace="t"
/db_xref="dbSNP:1403734724"
variation 48
/gene="MIR630"
/gene_synonym="hsa-mir-630; MIRN630"
/replace="a"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:774874333"
variation 49
/gene="MIR630"
/gene_synonym="hsa-mir-630; MIRN630"
/replace="a"
/replace="c"
/db_xref="dbSNP:1461447148"
variation 50..75
/gene="MIR630"
/gene_synonym="hsa-mir-630; MIRN630"
/replace="cag"
/replace="cagaatgacctagtattctgtaccag"
/db_xref="dbSNP:751079265"
variation 50
/gene="MIR630"
/gene_synonym="hsa-mir-630; MIRN630"
/replace="c"
/replace="cc"
/db_xref="dbSNP:766744804"
variation 52
/gene="MIR630"
/gene_synonym="hsa-mir-630; MIRN630"
/replace="a"
/replace="g"
/db_xref="dbSNP:765891587"
variation 54
/gene="MIR630"
/gene_synonym="hsa-mir-630; MIRN630"
/replace="a"
/replace="t"
/db_xref="dbSNP:776063319"
variation 57..73
/gene="MIR630"
/gene_synonym="hsa-mir-630; MIRN630"
/replace="acc"
/replace="acctagtattctgtacc"
/db_xref="dbSNP:2542784610"
variation 59
/gene="MIR630"
/gene_synonym="hsa-mir-630; MIRN630"
/replace="c"
/replace="g"
/db_xref="dbSNP:996560227"
ncRNA 61..82
/ncRNA_class="miRNA"
/gene="MIR630"
/gene_synonym="hsa-mir-630; MIRN630"
/product="hsa-miR-630"
/db_xref="miRBase:MIMAT0003299"
/db_xref="GeneID:693215"
/db_xref="HGNC:HGNC:32886"
/db_xref="miRBase:MI0003644"
variation 62
/gene="MIR630"
/gene_synonym="hsa-mir-630; MIRN630"
/replace="a"
/replace="g"
/db_xref="dbSNP:1172705615"
variation 64
/gene="MIR630"
/gene_synonym="hsa-mir-630; MIRN630"
/replace="a"
/replace="g"
/db_xref="dbSNP:2542784613"
variation 72..73
/gene="MIR630"
/gene_synonym="hsa-mir-630; MIRN630"
/replace="c"
/replace="cc"
/db_xref="dbSNP:1478064263"
variation 72
/gene="MIR630"
/gene_synonym="hsa-mir-630; MIRN630"
/replace="c"
/replace="t"
/db_xref="dbSNP:759224089"
variation 73
/gene="MIR630"
/gene_synonym="hsa-mir-630; MIRN630"
/replace="c"
/replace="t"
/db_xref="dbSNP:562760607"
variation 77
/gene="MIR630"
/gene_synonym="hsa-mir-630; MIRN630"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:2064321292"
variation 80
/gene="MIR630"
/gene_synonym="hsa-mir-630; MIRN630"
/replace="a"
/replace="g"
/db_xref="dbSNP:752489103"
variation 81
/gene="MIR630"
/gene_synonym="hsa-mir-630; MIRN630"
/replace="a"
/replace="g"
/db_xref="dbSNP:1011619093"
variation 82
/gene="MIR630"
/gene_synonym="hsa-mir-630; MIRN630"
/replace="c"
/replace="t"
/db_xref="dbSNP:2542784630"
variation 83
/gene="MIR630"
/gene_synonym="hsa-mir-630; MIRN630"
/replace="a"
/replace="g"
/db_xref="dbSNP:2064321336"
variation 87
/gene="MIR630"
/gene_synonym="hsa-mir-630; MIRN630"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1368026265"
variation 88
/gene="MIR630"
/gene_synonym="hsa-mir-630; MIRN630"
/replace="c"
/replace="t"
/db_xref="dbSNP:1030358336"
variation 91
/gene="MIR630"
/gene_synonym="hsa-mir-630; MIRN630"
/replace="a"
/replace="g"
/db_xref="dbSNP:758299822"
variation 92
/gene="MIR630"
/gene_synonym="hsa-mir-630; MIRN630"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:533218961"
variation 94..95
/gene="MIR630"
/gene_synonym="hsa-mir-630; MIRN630"
/replace=""
/replace="cat"
/db_xref="dbSNP:2064321414"
variation 94
/gene="MIR630"
/gene_synonym="hsa-mir-630; MIRN630"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:955437229"
variation 95
/gene="MIR630"
/gene_synonym="hsa-mir-630; MIRN630"
/replace="t"
/replace="tgtt"
/db_xref="dbSNP:1472412360"
variation 96..97
/gene="MIR630"
/gene_synonym="hsa-mir-630; MIRN630"
/replace=""
/replace="g"
/db_xref="dbSNP:2140443179"
variation 96
/gene="MIR630"
/gene_synonym="hsa-mir-630; MIRN630"
/replace="a"
/replace="g"
/db_xref="dbSNP:113971639"
ORIGIN
aacttaacatcatgctacctctttgtatcatattttgttattctggtcacagaatgacctagtattctgtaccagggaaggtagttcttaactatat
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]