GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2026-06-11 22:58:29, GGRNA.v2 : RefSeq release 233 (Jan, 2026)

LOCUS       NR_030359                 97 bp    RNA     linear   PRI 30-APR-2024
DEFINITION  Homo sapiens microRNA 630 (MIR630), microRNA.
ACCESSION   NR_030359
VERSION     NR_030359.1
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 97)
  AUTHORS   Cui,F., Sun,Z., Zhang,X. and Liu,C.
  TITLE     CircMAP3K4 Suppresses H2O2-Induced Human Lens Epithelial Cell
            Injury by miR-630/ERCC6 Axis in Age-Related Cataract
  JOURNAL   Curr Eye Res 49 (5), 487-495 (2024)
   PUBMED   38152055
  REMARK    GeneRIF: CircMAP3K4 Suppresses H2O2-Induced Human Lens Epithelial
            Cell Injury by miR-630/ERCC6 Axis in Age-Related Cataract.
REFERENCE   2  (bases 1 to 97)
  AUTHORS   You,G.R., Cheng,A.J., Shen,E.Y., Fan,K.H., Huang,Y.F., Huang,Y.C.,
            Chang,K.P. and Chang,J.T.
  TITLE     MiR-630 Promotes Radioresistance by Induction of Anti-Apoptotic
            Effect via Nrf2-GPX2 Molecular Axis in Head-Neck Cancer
  JOURNAL   Cells 12 (24), 2853 (2023)
   PUBMED   38132173
  REMARK    GeneRIF: MiR-630 Promotes Radioresistance by Induction of
            Anti-Apoptotic Effect via Nrf2-GPX2 Molecular Axis in Head-Neck
            Cancer.
            Publication Status: Online-Only
REFERENCE   3  (bases 1 to 97)
  AUTHORS   Li,X., Jiang,X., Lu,J., Lin,Y., Jiang,L., Li,Y., Wan,F. and Wang,C.
  TITLE     CircCERS6 Suppresses the Development of Epithelial Ovarian Cancer
            Through Mediating miR-630/RASSF8
  JOURNAL   Biochem Genet 60 (6), 2611-2629 (2022)
   PUBMED   35676548
  REMARK    GeneRIF: CircCERS6 Suppresses the Development of Epithelial Ovarian
            Cancer Through Mediating miR-630/RASSF8.
REFERENCE   4  (bases 1 to 97)
  AUTHORS   Gao,Q., Ren,Z., Jiao,S., Guo,J., Miao,X., Wang,J. and Liu,J.
  TITLE     HIF-3alpha-Induced miR-630 Expression Promotes Cancer Hallmarks in
            Cervical Cancer Cells by Forming a Positive Feedback Loop
  JOURNAL   J Immunol Res 2022, 5262963 (2022)
   PUBMED   36277475
  REMARK    GeneRIF: HIF-3alpha-Induced miR-630 Expression Promotes Cancer
            Hallmarks in Cervical Cancer Cells by Forming a Positive Feedback
            Loop.
            Publication Status: Online-Only
REFERENCE   5  (bases 1 to 97)
  AUTHORS   Chu,W.K., Hung,L.M., Hou,C.W. and Chen,J.K.
  TITLE     MicroRNA 630 Represses NANOG Expression through Transcriptional and
            Post-Transcriptional Regulation in Human Embryonal Carcinoma Cells
  JOURNAL   Int J Mol Sci 23 (1), 46 (2021)
   PUBMED   35008480
  REMARK    GeneRIF: MicroRNA 630 Represses NANOG Expression through
            Transcriptional and Post-Transcriptional Regulation in Human
            Embryonal Carcinoma Cells.
            Publication Status: Online-Only
REFERENCE   6  (bases 1 to 97)
  AUTHORS   Corcoran,C., Rani,S., Breslin,S., Gogarty,M., Ghobrial,I.M.,
            Crown,J. and O'Driscoll,L.
  TITLE     miR-630 targets IGF1R to regulate response to HER-targeting drugs
            and overall cancer cell progression in HER2 over-expressing breast
            cancer
  JOURNAL   Mol Cancer 13, 71 (2014)
   PUBMED   24655723
  REMARK    GeneRIF: our findings suggest miR-630 as a key regulator of cancer
            cell progression in HER2 over-expressing breast cancer, through
            targeting of IGF1R.
            Publication Status: Online-Only
REFERENCE   7  (bases 1 to 97)
  AUTHORS   Chu,D., Zhao,Z., Li,Y., Li,J., Zheng,J., Wang,W., Zhao,Q. and Ji,G.
  TITLE     Increased microRNA-630 expression in gastric cancer is associated
            with poor overall survival
  JOURNAL   PLoS One 9 (3), e90526 (2014)
   PUBMED   24621930
  REMARK    GeneRIF: over-expression of miR-630 and its association with tumor
            progression in human gastric cancer
            Publication Status: Online-Only
REFERENCE   8  (bases 1 to 97)
  AUTHORS   Farhana,L., Dawson,M.I., Murshed,F., Das,J.K., Rishi,A.K. and
            Fontana,J.A.
  TITLE     Upregulation of miR-150* and miR-630 induces apoptosis in
            pancreatic cancer cells by targeting IGF-1R
  JOURNAL   PLoS One 8 (5), e61015 (2013)
   PUBMED   23675407
  REMARK    GeneRIF: Upregulation of miR-150* and miR-630 induces apoptosis in
            pancreatic cancer cells by targeting IGF-1R.
            Publication Status: Online-Only
REFERENCE   9  (bases 1 to 97)
  AUTHORS   Cummins,J.M., He,Y., Leary,R.J., Pagliarini,R., Diaz,L.A. Jr.,
            Sjoblom,T., Barad,O., Bentwich,Z., Szafranska,A.E., Labourier,E.,
            Raymond,C.K., Roberts,B.S., Juhl,H., Kinzler,K.W., Vogelstein,B.
            and Velculescu,V.E.
  TITLE     The colorectal microRNAome
  JOURNAL   Proc Natl Acad Sci U S A 103 (10), 3687-3692 (2006)
   PUBMED   16505370
REFERENCE   10 (bases 1 to 97)
  AUTHORS   Griffiths-Jones,S., Grocock,R.J., van Dongen,S., Bateman,A. and
            Enright,A.J.
  TITLE     miRBase: microRNA sequences, targets and gene nomenclature
  JOURNAL   Nucleic Acids Res 34 (Database issue), D140-D144 (2006)
   PUBMED   16381832
COMMENT     PROVISIONAL REFSEQ: This record is based on preliminary annotation
            provided by NCBI staff in collaboration with miRBase. The reference
            sequence was derived from AC100827.2.
            
            Summary: microRNAs (miRNAs) are short (20-24 nt) non-coding RNAs
            that are involved in post-transcriptional regulation of gene
            expression in multicellular organisms by affecting both the
            stability and translation of mRNAs. miRNAs are transcribed by RNA
            polymerase II as part of capped and polyadenylated primary
            transcripts (pri-miRNAs) that can be either protein-coding or
            non-coding. The primary transcript is cleaved by the Drosha
            ribonuclease III enzyme to produce an approximately 70-nt stem-loop
            precursor miRNA (pre-miRNA), which is further cleaved by the
            cytoplasmic Dicer ribonuclease to generate the mature miRNA and
            antisense miRNA star (miRNA*) products. The mature miRNA is
            incorporated into a RNA-induced silencing complex (RISC), which
            recognizes target mRNAs through imperfect base pairing with the
            miRNA and most commonly results in translational inhibition or
            destabilization of the target mRNA. The RefSeq represents the
            predicted microRNA stem-loop. [provided by RefSeq, Sep 2009].
            
            Sequence Note: This record represents a predicted microRNA
            stem-loop as defined by miRBase. Some sequence at the 5' and 3'
            ends may not be included in the intermediate precursor miRNA
            produced by Drosha cleavage.
            
            Publication Note:  This RefSeq record includes a subset of the
            publications that are available for this gene. Please see the Gene
            record to access additional publications.
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-97                AC100827.2         67632-67728         c
FEATURES             Location/Qualifiers
     source          1..97
                     /organism="Homo sapiens"
                     /mol_type="transcribed RNA"
                     /db_xref="taxon:9606"
                     /chromosome="15"
                     /map="15q24.1"
     gene            1..97
                     /gene="MIR630"
                     /gene_synonym="hsa-mir-630; MIRN630"
                     /note="microRNA 630"
                     /db_xref="GeneID:693215"
                     /db_xref="HGNC:HGNC:32886"
                     /db_xref="miRBase:MI0003644"
     precursor_RNA   1..97
                     /gene="MIR630"
                     /gene_synonym="hsa-mir-630; MIRN630"
                     /product="microRNA 630"
                     /db_xref="GeneID:693215"
                     /db_xref="HGNC:HGNC:32886"
                     /db_xref="miRBase:MI0003644"
     exon            1..97
                     /gene="MIR630"
                     /gene_synonym="hsa-mir-630; MIRN630"
                     /inference="alignment:Splign:2.1.0"
     variation       2
                     /gene="MIR630"
                     /gene_synonym="hsa-mir-630; MIRN630"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2542784535"
     variation       4..5
                     /gene="MIR630"
                     /gene_synonym="hsa-mir-630; MIRN630"
                     /replace=""
                     /replace="tt"
                     /db_xref="dbSNP:750725925"
     variation       7..9
                     /gene="MIR630"
                     /gene_synonym="hsa-mir-630; MIRN630"
                     /replace="a"
                     /replace="aca"
                     /db_xref="dbSNP:2064320865"
     variation       8..13
                     /gene="MIR630"
                     /gene_synonym="hsa-mir-630; MIRN630"
                     /replace="cat"
                     /replace="catcat"
                     /db_xref="dbSNP:1310846413"
     variation       8
                     /gene="MIR630"
                     /gene_synonym="hsa-mir-630; MIRN630"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1404480992"
     variation       9
                     /gene="MIR630"
                     /gene_synonym="hsa-mir-630; MIRN630"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:775762051"
     variation       10
                     /gene="MIR630"
                     /gene_synonym="hsa-mir-630; MIRN630"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1402253095"
     variation       11
                     /gene="MIR630"
                     /gene_synonym="hsa-mir-630; MIRN630"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2064320935"
     variation       12
                     /gene="MIR630"
                     /gene_synonym="hsa-mir-630; MIRN630"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1444076655"
     variation       13
                     /gene="MIR630"
                     /gene_synonym="hsa-mir-630; MIRN630"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2064320964"
     variation       14
                     /gene="MIR630"
                     /gene_synonym="hsa-mir-630; MIRN630"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2140443122"
     variation       16
                     /gene="MIR630"
                     /gene_synonym="hsa-mir-630; MIRN630"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1308114046"
     variation       17
                     /gene="MIR630"
                     /gene_synonym="hsa-mir-630; MIRN630"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:749669360"
     variation       18
                     /gene="MIR630"
                     /gene_synonym="hsa-mir-630; MIRN630"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1246367207"
     variation       19
                     /gene="MIR630"
                     /gene_synonym="hsa-mir-630; MIRN630"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2064321022"
     variation       27
                     /gene="MIR630"
                     /gene_synonym="hsa-mir-630; MIRN630"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2064321038"
     variation       31
                     /gene="MIR630"
                     /gene_synonym="hsa-mir-630; MIRN630"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:769105916"
     variation       33..36
                     /gene="MIR630"
                     /gene_synonym="hsa-mir-630; MIRN630"
                     /replace="ttt"
                     /replace="tttt"
                     /db_xref="dbSNP:1341482597"
     variation       33
                     /gene="MIR630"
                     /gene_synonym="hsa-mir-630; MIRN630"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1356253254"
     variation       34
                     /gene="MIR630"
                     /gene_synonym="hsa-mir-630; MIRN630"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1053789818"
     variation       40
                     /gene="MIR630"
                     /gene_synonym="hsa-mir-630; MIRN630"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2064321101"
     variation       41
                     /gene="MIR630"
                     /gene_synonym="hsa-mir-630; MIRN630"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1311959732"
     variation       45..46
                     /gene="MIR630"
                     /gene_synonym="hsa-mir-630; MIRN630"
                     /replace="g"
                     /replace="gg"
                     /db_xref="dbSNP:758978114"
     variation       46
                     /gene="MIR630"
                     /gene_synonym="hsa-mir-630; MIRN630"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:900622609"
     variation       47
                     /gene="MIR630"
                     /gene_synonym="hsa-mir-630; MIRN630"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1403734724"
     variation       48
                     /gene="MIR630"
                     /gene_synonym="hsa-mir-630; MIRN630"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:774874333"
     variation       49
                     /gene="MIR630"
                     /gene_synonym="hsa-mir-630; MIRN630"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1461447148"
     variation       50..75
                     /gene="MIR630"
                     /gene_synonym="hsa-mir-630; MIRN630"
                     /replace="cag"
                     /replace="cagaatgacctagtattctgtaccag"
                     /db_xref="dbSNP:751079265"
     variation       50
                     /gene="MIR630"
                     /gene_synonym="hsa-mir-630; MIRN630"
                     /replace="c"
                     /replace="cc"
                     /db_xref="dbSNP:766744804"
     variation       52
                     /gene="MIR630"
                     /gene_synonym="hsa-mir-630; MIRN630"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:765891587"
     variation       54
                     /gene="MIR630"
                     /gene_synonym="hsa-mir-630; MIRN630"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:776063319"
     variation       57..73
                     /gene="MIR630"
                     /gene_synonym="hsa-mir-630; MIRN630"
                     /replace="acc"
                     /replace="acctagtattctgtacc"
                     /db_xref="dbSNP:2542784610"
     variation       59
                     /gene="MIR630"
                     /gene_synonym="hsa-mir-630; MIRN630"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:996560227"
     ncRNA           61..82
                     /ncRNA_class="miRNA"
                     /gene="MIR630"
                     /gene_synonym="hsa-mir-630; MIRN630"
                     /product="hsa-miR-630"
                     /db_xref="miRBase:MIMAT0003299"
                     /db_xref="GeneID:693215"
                     /db_xref="HGNC:HGNC:32886"
                     /db_xref="miRBase:MI0003644"
     variation       62
                     /gene="MIR630"
                     /gene_synonym="hsa-mir-630; MIRN630"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1172705615"
     variation       64
                     /gene="MIR630"
                     /gene_synonym="hsa-mir-630; MIRN630"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2542784613"
     variation       72..73
                     /gene="MIR630"
                     /gene_synonym="hsa-mir-630; MIRN630"
                     /replace="c"
                     /replace="cc"
                     /db_xref="dbSNP:1478064263"
     variation       72
                     /gene="MIR630"
                     /gene_synonym="hsa-mir-630; MIRN630"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:759224089"
     variation       73
                     /gene="MIR630"
                     /gene_synonym="hsa-mir-630; MIRN630"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:562760607"
     variation       77
                     /gene="MIR630"
                     /gene_synonym="hsa-mir-630; MIRN630"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:2064321292"
     variation       80
                     /gene="MIR630"
                     /gene_synonym="hsa-mir-630; MIRN630"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:752489103"
     variation       81
                     /gene="MIR630"
                     /gene_synonym="hsa-mir-630; MIRN630"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1011619093"
     variation       82
                     /gene="MIR630"
                     /gene_synonym="hsa-mir-630; MIRN630"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2542784630"
     variation       83
                     /gene="MIR630"
                     /gene_synonym="hsa-mir-630; MIRN630"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2064321336"
     variation       87
                     /gene="MIR630"
                     /gene_synonym="hsa-mir-630; MIRN630"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1368026265"
     variation       88
                     /gene="MIR630"
                     /gene_synonym="hsa-mir-630; MIRN630"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1030358336"
     variation       91
                     /gene="MIR630"
                     /gene_synonym="hsa-mir-630; MIRN630"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:758299822"
     variation       92
                     /gene="MIR630"
                     /gene_synonym="hsa-mir-630; MIRN630"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:533218961"
     variation       94..95
                     /gene="MIR630"
                     /gene_synonym="hsa-mir-630; MIRN630"
                     /replace=""
                     /replace="cat"
                     /db_xref="dbSNP:2064321414"
     variation       94
                     /gene="MIR630"
                     /gene_synonym="hsa-mir-630; MIRN630"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:955437229"
     variation       95
                     /gene="MIR630"
                     /gene_synonym="hsa-mir-630; MIRN630"
                     /replace="t"
                     /replace="tgtt"
                     /db_xref="dbSNP:1472412360"
     variation       96..97
                     /gene="MIR630"
                     /gene_synonym="hsa-mir-630; MIRN630"
                     /replace=""
                     /replace="g"
                     /db_xref="dbSNP:2140443179"
     variation       96
                     /gene="MIR630"
                     /gene_synonym="hsa-mir-630; MIRN630"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:113971639"
ORIGIN      
aacttaacatcatgctacctctttgtatcatattttgttattctggtcacagaatgacctagtattctgtaccagggaaggtagttcttaactatat
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]