ver.2
Home
|
Help
|
Advanced search
Previous release (v1)
2025-07-13 15:39:36, GGRNA.v2 : RefSeq release 229 (Mar, 2025)
LOCUS NR_029477 72 bp RNA linear PRI 17-FEB-2025
DEFINITION Homo sapiens microRNA let-7a-2 (MIRLET7A2), microRNA.
ACCESSION NR_029477
VERSION NR_029477.1
KEYWORDS RefSeq.
SOURCE Homo sapiens (human)
ORGANISM Homo sapiens
Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
Catarrhini; Hominidae; Homo.
REFERENCE 1 (bases 1 to 72)
AUTHORS Dong,Q., Qiu,H., Piao,C., Li,Z. and Cui,X.
TITLE LncRNA SNHG4 promotes prostate cancer cell survival and resistance
to enzalutamide through a let-7a/RREB1 positive feedback loop and a
ceRNA network
JOURNAL J Exp Clin Cancer Res 42 (1), 209 (2023)
PUBMED 37596700
REMARK GeneRIF: LncRNA SNHG4 promotes prostate cancer cell survival and
resistance to enzalutamide through a let-7a/RREB1 positive feedback
loop and a ceRNA network.
Publication Status: Online-Only
REFERENCE 2 (bases 1 to 72)
AUTHORS Liu,X., Chen,Z., Li,S., Jin,L., Cui,X., Cui,C., Deng,Y., Gao,Q.,
Fan,L., Niu,Y., Wang,W., Cui,C., Zhong,J., Cui,Q., Geng,B. and
Cai,J.
TITLE Pre-miRNA Hsa-Let-7a-2: a Novel Intracellular Partner of
Angiotensin II Type 2 Receptor Negatively Regulating its Signals
JOURNAL Int J Biol Sci 18 (8), 3237-3250 (2022)
PUBMED 35637969
REMARK GeneRIF: Pre-miRNA Hsa-Let-7a-2: a Novel Intracellular Partner of
Angiotensin II Type 2 Receptor Negatively Regulating its Signals.
Publication Status: Online-Only
REFERENCE 3 (bases 1 to 72)
AUTHORS Xie,X., Du,D., Guan,Y., Jin,T., Chen,J., Wang,Q., Li,D., Xie,Y.,
Liu,N. and Xie,P.
TITLE Predictive Value of let-7a for Cancer Cell Repopulation between
Chemotherapy and Long-Term Survival: A Prospective Study
JOURNAL Ann Clin Lab Sci 51 (5), 638-645 (2021)
PUBMED 34686505
REMARK GeneRIF: Predictive Value of let-7a for Cancer Cell Repopulation
between Chemotherapy and Long-Term Survival: A Prospective Study.
REFERENCE 4 (bases 1 to 72)
AUTHORS Fadhil,R.S., Wei,M.Q., Nikolarakos,D., Good,D. and Nair,R.G.
TITLE Salivary microRNA miR-let-7a-5p and miR-3928 could be used as
potential diagnostic bio-markers for head and neck squamous cell
carcinoma
JOURNAL PLoS One 15 (3), e0221779 (2020)
PUBMED 32208417
REMARK GeneRIF: Salivary miR-let-7a-5p and miR-3928 were significantly
down regulated in saliva of head and neck squamous cell carcinoma
patients, and have the potential to be novel non-invasive
biomarkers for early detection and prognosis head and neck squamous
cell carcinoma.
Publication Status: Online-Only
REFERENCE 5 (bases 1 to 72)
AUTHORS Liu,H. and Jiang,B.
TITLE Let-7a-5p represses proliferation, migration, invasion and
epithelial-mesenchymal transition by targeting Smad2 in
TGF-b2-induced human lens epithelial cells
JOURNAL J Biosci 45 (2020)
PUBMED 32345785
REMARK GeneRIF: Let-7a-5p represses proliferation, migration, invasion and
epithelial-mesenchymal transition by targeting Smad2 in
TGF-b2-induced human lens epithelial cells.
REFERENCE 6 (bases 1 to 72)
AUTHORS Kasashima,K., Nakamura,Y. and Kozu,T.
TITLE Altered expression profiles of microRNAs during TPA-induced
differentiation of HL-60 cells
JOURNAL Biochem Biophys Res Commun 322 (2), 403-410 (2004)
PUBMED 15325244
REFERENCE 7 (bases 1 to 72)
AUTHORS Suh,M.R., Lee,Y., Kim,J.Y., Kim,S.K., Moon,S.H., Lee,J.Y.,
Cha,K.Y., Chung,H.M., Yoon,H.S., Moon,S.Y., Kim,V.N. and Kim,K.S.
TITLE Human embryonic stem cells express a unique set of microRNAs
JOURNAL Dev Biol 270 (2), 488-498 (2004)
PUBMED 15183728
REFERENCE 8 (bases 1 to 72)
AUTHORS Michael,M.Z., O' Connor,S.M., van Holst Pellekaan,N.G., Young,G.P.
and James,R.J.
TITLE Reduced accumulation of specific microRNAs in colorectal neoplasia
JOURNAL Mol Cancer Res 1 (12), 882-891 (2003)
PUBMED 14573789
REFERENCE 9 (bases 1 to 72)
AUTHORS Dostie,J., Mourelatos,Z., Yang,M., Sharma,A. and Dreyfuss,G.
TITLE Numerous microRNPs in neuronal cells containing novel microRNAs
JOURNAL RNA 9 (2), 180-186 (2003)
PUBMED 12554860
REMARK Erratum:[RNA. 2003 May;9(5):631-2]
REFERENCE 10 (bases 1 to 72)
AUTHORS Lagos-Quintana,M., Rauhut,R., Lendeckel,W. and Tuschl,T.
TITLE Identification of novel genes coding for small expressed RNAs
JOURNAL Science 294 (5543), 853-858 (2001)
PUBMED 11679670
COMMENT PROVISIONAL REFSEQ: This record is based on preliminary annotation
provided by NCBI staff in collaboration with miRBase. The reference
sequence was derived from AP001359.4.
Summary: microRNAs (miRNAs) are short (20-24 nt) non-coding RNAs
that are involved in post-transcriptional regulation of gene
expression in multicellular organisms by affecting both the
stability and translation of mRNAs. miRNAs are transcribed by RNA
polymerase II as part of capped and polyadenylated primary
transcripts (pri-miRNAs) that can be either protein-coding or
non-coding. The primary transcript is cleaved by the Drosha
ribonuclease III enzyme to produce an approximately 70-nt stem-loop
precursor miRNA (pre-miRNA), which is further cleaved by the
cytoplasmic Dicer ribonuclease to generate the mature miRNA and
antisense miRNA star (miRNA*) products. The mature miRNA is
incorporated into a RNA-induced silencing complex (RISC), which
recognizes target mRNAs through imperfect base pairing with the
miRNA and most commonly results in translational inhibition or
destabilization of the target mRNA. The RefSeq represents the
predicted microRNA stem-loop. [provided by RefSeq, Sep 2009].
Sequence Note: This record represents a predicted microRNA
stem-loop as defined by miRBase. Some sequence at the 5' and 3'
ends may not be included in the intermediate precursor miRNA
produced by Drosha cleavage.
Publication Note: This RefSeq record includes a subset of the
publications that are available for this gene. Please see the Gene
record to access additional publications.
##Evidence-Data-START##
Transcript is intronless :: LM608150.1 [ECO:0000345]
##Evidence-Data-END##
PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP
1-72 AP001359.4 114480-114551 c
FEATURES Location/Qualifiers
source 1..72
/organism="Homo sapiens"
/mol_type="transcribed RNA"
/db_xref="taxon:9606"
/chromosome="11"
/map="11q24.1"
gene 1..72
/gene="MIRLET7A2"
/gene_synonym="let-7a-2; LET7A2; MIRNLET7A2"
/note="microRNA let-7a-2"
/db_xref="GeneID:406882"
/db_xref="HGNC:HGNC:31477"
/db_xref="MIM:612142"
/db_xref="miRBase:MI0000061"
precursor_RNA 1..72
/gene="MIRLET7A2"
/gene_synonym="let-7a-2; LET7A2; MIRNLET7A2"
/product="microRNA let-7a-2"
/db_xref="GeneID:406882"
/db_xref="HGNC:HGNC:31477"
/db_xref="MIM:612142"
/db_xref="miRBase:MI0000061"
exon 1..72
/gene="MIRLET7A2"
/gene_synonym="let-7a-2; LET7A2; MIRNLET7A2"
/inference="alignment:Splign:2.1.0"
variation 1
/gene="MIRLET7A2"
/gene_synonym="let-7a-2; LET7A2; MIRNLET7A2"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:1942706673"
variation 2
/gene="MIRLET7A2"
/gene_synonym="let-7a-2; LET7A2; MIRNLET7A2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1023002595"
ncRNA 5..26
/ncRNA_class="miRNA"
/gene="MIRLET7A2"
/gene_synonym="let-7a-2; LET7A2; MIRNLET7A2"
/product="hsa-let-7a-5p"
/db_xref="miRBase:MIMAT0000062"
/db_xref="GeneID:406882"
/db_xref="HGNC:HGNC:31477"
/db_xref="MIM:612142"
/db_xref="miRBase:MI0000061"
variation 10
/gene="MIRLET7A2"
/gene_synonym="let-7a-2; LET7A2; MIRNLET7A2"
/replace="g"
/replace="t"
/db_xref="dbSNP:1362975136"
variation 12
/gene="MIRLET7A2"
/gene_synonym="let-7a-2; LET7A2; MIRNLET7A2"
/replace="a"
/replace="g"
/db_xref="dbSNP:2496901589"
variation 19
/gene="MIRLET7A2"
/gene_synonym="let-7a-2; LET7A2; MIRNLET7A2"
/replace="a"
/replace="g"
/db_xref="dbSNP:1176612700"
variation 21
/gene="MIRLET7A2"
/gene_synonym="let-7a-2; LET7A2; MIRNLET7A2"
/replace="a"
/replace="g"
/db_xref="dbSNP:760725471"
variation 24
/gene="MIRLET7A2"
/gene_synonym="let-7a-2; LET7A2; MIRNLET7A2"
/replace="c"
/replace="g"
/db_xref="dbSNP:2496901547"
variation 25
/gene="MIRLET7A2"
/gene_synonym="let-7a-2; LET7A2; MIRNLET7A2"
/replace="c"
/replace="t"
/db_xref="dbSNP:770465876"
variation 27
/gene="MIRLET7A2"
/gene_synonym="let-7a-2; LET7A2; MIRNLET7A2"
/replace="c"
/replace="t"
/db_xref="dbSNP:370340749"
polyA_site 28
/gene="MIRLET7A2"
/gene_synonym="let-7a-2; LET7A2; MIRNLET7A2"
/note="major polyA site"
variation 31..32
/gene="MIRLET7A2"
/gene_synonym="let-7a-2; LET7A2; MIRNLET7A2"
/replace="at"
/replace="atat"
/db_xref="dbSNP:1942705719"
variation 32
/gene="MIRLET7A2"
/gene_synonym="let-7a-2; LET7A2; MIRNLET7A2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1942705572"
variation 35..36
/gene="MIRLET7A2"
/gene_synonym="let-7a-2; LET7A2; MIRNLET7A2"
/replace=""
/replace="tatatatacagtt"
/db_xref="dbSNP:778742532"
variation 35
/gene="MIRLET7A2"
/gene_synonym="let-7a-2; LET7A2; MIRNLET7A2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1942705433"
variation 36
/gene="MIRLET7A2"
/gene_synonym="let-7a-2; LET7A2; MIRNLET7A2"
/replace="a"
/replace="g"
/db_xref="dbSNP:2496901455"
variation 37
/gene="MIRLET7A2"
/gene_synonym="let-7a-2; LET7A2; MIRNLET7A2"
/replace="c"
/replace="t"
/db_xref="dbSNP:772905825"
variation 38
/gene="MIRLET7A2"
/gene_synonym="let-7a-2; LET7A2; MIRNLET7A2"
/replace="c"
/replace="g"
/db_xref="dbSNP:1285776542"
variation 41
/gene="MIRLET7A2"
/gene_synonym="let-7a-2; LET7A2; MIRNLET7A2"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:1205331984"
variation 42
/gene="MIRLET7A2"
/gene_synonym="let-7a-2; LET7A2; MIRNLET7A2"
/replace="a"
/replace="g"
/db_xref="dbSNP:769568675"
variation 44
/gene="MIRLET7A2"
/gene_synonym="let-7a-2; LET7A2; MIRNLET7A2"
/replace="a"
/replace="g"
/db_xref="dbSNP:561124326"
variation 46
/gene="MIRLET7A2"
/gene_synonym="let-7a-2; LET7A2; MIRNLET7A2"
/replace="a"
/replace="t"
/db_xref="dbSNP:2496901347"
ncRNA 50..71
/ncRNA_class="miRNA"
/gene="MIRLET7A2"
/gene_synonym="let-7a-2; LET7A2; MIRNLET7A2"
/product="hsa-let-7a-2-3p"
/db_xref="miRBase:MIMAT0010195"
/db_xref="GeneID:406882"
/db_xref="HGNC:HGNC:31477"
/db_xref="MIM:612142"
/db_xref="miRBase:MI0000061"
variation 50
/gene="MIRLET7A2"
/gene_synonym="let-7a-2; LET7A2; MIRNLET7A2"
/replace="a"
/replace="c"
/db_xref="dbSNP:2134641361"
variation 51..53
/gene="MIRLET7A2"
/gene_synonym="let-7a-2; LET7A2; MIRNLET7A2"
/replace="t"
/replace="tgt"
/db_xref="dbSNP:2496901301"
variation 52
/gene="MIRLET7A2"
/gene_synonym="let-7a-2; LET7A2; MIRNLET7A2"
/replace="a"
/replace="g"
/db_xref="dbSNP:2496901311"
variation 54
/gene="MIRLET7A2"
/gene_synonym="let-7a-2; LET7A2; MIRNLET7A2"
/replace="a"
/replace="g"
/db_xref="dbSNP:2496901286"
variation 59
/gene="MIRLET7A2"
/gene_synonym="let-7a-2; LET7A2; MIRNLET7A2"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:781140476"
ORIGIN
aggttgaggtagtaggttgtatagtttagaattacatcaagggagataactgtacagcctcctagctttcct
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]