GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2024-07-23 22:57:25, GGRNA.v2 : RefSeq release 224 (May, 2024)

LOCUS       NR_015480                687 bp    RNA     linear   ROD 05-AUG-2023
DEFINITION  Mus musculus metastasis associated gene 2 (Mtag2), transcript
            variant 2, long non-coding RNA.
ACCESSION   NR_015480
VERSION     NR_015480.2
KEYWORDS    RefSeq.
SOURCE      Mus musculus (house mouse)
  ORGANISM  Mus musculus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha;
            Muroidea; Muridae; Murinae; Mus; Mus.
REFERENCE   1  (bases 1 to 687)
  AUTHORS   Ishiguro T, Nagawa H, Naito M and Tsuruo T.
  TITLE     Analysis of novel metastasis-associated gene TI-227
  JOURNAL   Jpn J Cancer Res 91 (4), 390-394 (2000)
   PUBMED   10804286
REFERENCE   2  (bases 1 to 687)
  AUTHORS   Kelly CD, Carter ND, Jeffery S and Edwards YH.
  TITLE     Characterisation of cDNA clones for rat muscle carbonic anhydrase
            III
  JOURNAL   Biosci Rep 8 (5), 401-406 (1988)
   PUBMED   2852973
COMMENT     VALIDATED REFSEQ: This record has undergone validation or
            preliminary review. The reference sequence was derived from
            BB640217.1 and BB250987.2.
            
            On Jan 24, 2017 this sequence version replaced NR_015480.1.
            
            Transcript Variant: This variant (2) contains an alternate exon, as
            compared to variant 1.
            
            ##Evidence-Data-START##
            Transcript exon combination :: AK042966.1, BB640217.1 [ECO:0000332]
            RNAseq introns              :: single sample supports all introns
                                           SAMN00849376, SAMN00849379
                                           [ECO:0000348]
            ##Evidence-Data-END##
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-250               BB640217.1         1-250
            251-687             BB250987.2         50-486
FEATURES             Location/Qualifiers
     source          1..687
                     /organism="Mus musculus"
                     /mol_type="transcribed RNA"
                     /strain="C57BL/6"
                     /db_xref="taxon:10090"
                     /chromosome="7"
                     /map="7 29.28 cM"
     gene            1..687
                     /gene="Mtag2"
                     /gene_synonym="MAG"
                     /note="metastasis associated gene 2"
                     /db_xref="GeneID:50994"
                     /db_xref="MGI:MGI:1860766"
     ncRNA           1..687
                     /ncRNA_class="lncRNA"
                     /gene="Mtag2"
                     /gene_synonym="MAG"
                     /product="metastasis associated gene 2, transcript variant
                     2"
                     /db_xref="GeneID:50994"
                     /db_xref="MGI:MGI:1860766"
     exon            1..114
                     /gene="Mtag2"
                     /gene_synonym="MAG"
                     /inference="alignment:Splign:2.1.0"
     exon            115..687
                     /gene="Mtag2"
                     /gene_synonym="MAG"
                     /inference="alignment:Splign:2.1.0"
ORIGIN      
gagatgggggaggcgaggctaccgagagctgaccatggacagctccggcgcgggcctgtgtccagggcgagccggcctggaccgaggaacgtctccggttgattcaaccagaagacaagggcggctcccggaaggatgtgctcggttggaaggtgaggcaagtggacgacgggtggcgagtgcgtgttactctgcacccctgcgcccgtctagggtactgcatgcgccccaccaacccgactcctacgcagacggtggcacggcccgcaagggttcccccagtggatggttcgctccgccccgcctacagaggcaatgatcaggcggcttctgctggtttcaagactcccgcgtccgactcactggagaccttgccaggccttggccttccgaacctcttaagggttgggggcagtggtctttagtggtgctccctggcgctcacatagacgcagccttgggtcgggctagtctctgggacaccggccagcctccgccttcagagctgcgcgagcgttgtctatcatggtacacagactggaatgagcttgttcttaacctcagcttcactgtcctcctcccccacagagactattccaggatgcgcgacagacacacaagacactcggtgagggttaaagatctttaaataaggagccagtgacaataaataatactgtacagggg
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]