GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2020-11-27 03:41:20, GGRNA.v2 : RefSeq release 202 (Sep, 2020)

LOCUS       NM_214561               1402 bp    mRNA    linear   INV 30-SEP-2019
DEFINITION  Strongylocentrotus purpuratus homeobox (H-6 family) (HMX), mRNA.
ACCESSION   NM_214561
VERSION     NM_214561.2
KEYWORDS    RefSeq.
SOURCE      Strongylocentrotus purpuratus (purple sea urchin)
  ORGANISM  Strongylocentrotus purpuratus
            Eukaryota; Metazoa; Echinodermata; Eleutherozoa; Echinozoa;
            Echinoidea; Euechinoidea; Echinacea; Echinoida;
            Strongylocentrotidae; Strongylocentrotus.
REFERENCE   1  (bases 1 to 1402)
  AUTHORS   Tu Q, Cameron RA, Worley KC, Gibbs RA and Davidson EH.
  TITLE     Gene structure in the sea urchin Strongylocentrotus purpuratus
            based on transcriptome analysis
  JOURNAL   Genome Res. 22 (10), 2079-2087 (2012)
   PUBMED   22709795
REFERENCE   2  (bases 1 to 1402)
  AUTHORS   Martinez P and Davidson EH.
  TITLE     SpHmx, a sea urchin homeobox gene expressed in embryonic pigment
            cells
  JOURNAL   Dev. Biol. 181 (2), 213-222 (1997)
   PUBMED   9013931
COMMENT     PROVISIONAL REFSEQ: This record has not yet been subject to final
            NCBI review. The reference sequence was derived from D85079.1.
            On Aug 31, 2012 this sequence version replaced NM_214561.1.
            
            ##Evidence-Data-START##
            Transcript exon combination :: D85079.1, JT104524.1 [ECO:0000332]
            RNAseq introns              :: single sample supports all introns
                                           SAMN01096960, SAMN01103178
                                           [ECO:0000348]
            ##Evidence-Data-END##
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-1402              D85079.1           34-1435
FEATURES             Location/Qualifiers
     source          1..1402
                     /organism="Strongylocentrotus purpuratus"
                     /mol_type="mRNA"
                     /db_xref="taxon:7668"
     gene            1..1402
                     /gene="HMX"
                     /gene_synonym="homeobox; SpHmx"
                     /note="homeobox (H-6 family)"
                     /db_xref="GeneID:373358"
     misc_feature    110..112
                     /gene="HMX"
                     /gene_synonym="homeobox; SpHmx"
                     /note="upstream in-frame stop codon"
     CDS             122..1339
                     /gene="HMX"
                     /gene_synonym="homeobox; SpHmx"
                     /codon_start=1
                     /product="homeobox protein Hmx"
                     /protein_id="NP_999726.1"
                     /db_xref="GeneID:373358"
                     /translation="
MDSSRELSGEEPRSPSPRHETSKMRLSPDRPSHHPARPPASLASQPLRPAHYQDDDDSYRTHTPPPSQPRTKGFSIESILSPTDKHRKSPRSPPMSPSSPSMSSNGYSEGPIYGSTRHPLSATVPGLGRAALDELAAHRAAALHIPSAALPFSHLAHNPAFYAWMHGASFLHYHGMPAFNSHPPIAQPLTNSSRLAMAKDISPRPTQSHSSFGEEGGEKDSRGRESPDSEHRRNNGHEEDDDDDDDQSPQKKKKKTRTVFSRSQVFQLESTFEVKRYLSSSERAGLAANLHLTETQVKIWFQNRRNKWKRQMAAELESANLAHAAQIRAQANLAQVSAVHVHAYAQRMVRVPILYHENHPTTGSSLHSPNILPFPMPYPGSYHQISSSTSSTSSARSPTSTSIVT"
     misc_feature    order(881..895,899..901,950..952,968..970,1007..1009,
                     1013..1018,1025..1030,1034..1042,1046..1051)
                     /gene="HMX"
                     /gene_synonym="homeobox; SpHmx"
                     /note="DNA binding site [nucleotide binding]"
                     /db_xref="CDD:238039"
     misc_feature    887..1048
                     /gene="HMX"
                     /gene_synonym="homeobox; SpHmx"
                     /note="Homeobox domain; Region: Homeobox; pfam00046"
                     /db_xref="CDD:278475"
     misc_feature    order(887..889,896..898,1016..1018,1025..1030,1037..1039)
                     /gene="HMX"
                     /gene_synonym="homeobox; SpHmx"
                     /note="specific DNA base contacts [nucleotide binding];
                     other site"
                     /db_xref="CDD:238039"
ORIGIN      
cggccgcttggaaatgctagcttgtatttgaatgtattaatgatttgaattcgtcgtttgaaggttgaagttatcggagaagtatcacttttggctctttcaaacattttgatcgttatctatggacagtagccgtgaactatcaggagaggaacccagatctccatctccacgccacgaaacgagcaagatgcgtctatcacctgaccgacccagtcatcacccagcccgaccccccgcatctctggcgtcgcaaccactccgccctgctcattatcaagacgacgatgatagctaccgtacacacaccccgccaccgagccaaccgagaacgaagggcttcagcatcgagagcattctctcaccgacggacaagcatcggaagtcgccgagatcacccccgatgtcgccatccagtccgtcgatgtccagcaatgggtacagtgaagggcccatatacggctccactcgacacccactatcggcgaccgttccggggttgggacgggcggcgttggatgagcttgccgctcaccgagcagcggctctccatatcccttctgccgcactccccttctctcacctagcgcacaaccctgccttttatgcctggatgcacggggcatccttcttgcattatcacggcatgccggctttcaactcgcacccaccgatagcccagccactaaccaacagtagccgtctcgctatggccaaggatatctcacctcgaccaactcaatcccatagcagcttcggcgaggaaggcggcgagaaagacagtcgtggtcgcgaatcgcccgattccgaacaccgtcgaaataatggacacgaagaagacgatgatgacgacgacgatcaatcgccgcaaaagaagaagaaaaagacgagaactgtcttttcgcgaagtcaggtctttcaacttgaatcgacgtttgaagtgaagcggtacctgtctagttctgagcgggctggactagcagcgaatcttcacctgacggagacccaggtcaagatctggttccagaaccgtcgcaacaagtggaagcggcagatggccgccgagttggagtcggccaatctggctcacgccgcccagatacgcgctcaggcaaacctcgcgcaggtcagcgctgtgcatgttcatgcgtatgcgcagcgtatggtccgcgtaccgatactctatcacgagaatcatcccaccacgggttcgagtctgcactcgcctaacatcttgcctttcccgatgccgtaccccggttcgtatcatcaaatcagctcgtcaacatcgtctacatcatcagcgagatcgcccacgtcaaccagtattgtgacatgaagtgtgacccgttgataacggaacaatgctattcgtatgaagaaggcaactttcccggattct
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]