GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2020-11-27 00:44:44, GGRNA.v2 : RefSeq release 202 (Sep, 2020)

LOCUS       NM_206862               9704 bp    mRNA    linear   PRI 04-JUL-2020
DEFINITION  Homo sapiens transforming acidic coiled-coil containing protein 2
            (TACC2), transcript variant 1, mRNA.
ACCESSION   NM_206862
VERSION     NM_206862.4
KEYWORDS    RefSeq; MANE Select.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 9704)
  AUTHORS   Shakya M, Zhou A, Dai D, Zhong Q, Zhou Z, Zhang Y, Li X, Bholee AK
            and Chen M.
  TITLE     High expression of TACC2 in hepatocellular carcinoma is associated
            with poor prognosis
  JOURNAL   Cancer Biomark 22 (4), 611-619 (2018)
   PUBMED   29843208
  REMARK    GeneRIF: This finding suggests that TACC2 may be a useful tool as a
            candidate biomarker to predict the recurrence and prognosis of
            hepatocellular carcinoma.
REFERENCE   2  (bases 1 to 9704)
  AUTHORS   Yoshida E, Terao Y, Hayashi N, Mogushi K, Arakawa A, Tanaka Y, Ito
            Y, Ohmiya H, Hayashizaki Y, Takeda S, Itoh M and Kawaji H.
  TITLE     Promoter-level transcriptome in primary lesions of endometrial
            cancer identified biomarkers associated with lymph node metastasis
  JOURNAL   Sci Rep 7 (1), 14160 (2017)
   PUBMED   29074988
  REMARK    GeneRIF: TACC2 protein is expressed mainly in the nucleus of the
            endometrial cancer cells.
            Publication Status: Online-Only
REFERENCE   3  (bases 1 to 9704)
  AUTHORS   Onodera Y, Takagi K, Miki Y, Takayama K, Shibahara Y, Watanabe M,
            Ishida T, Inoue S, Sasano H and Suzuki T.
  TITLE     TACC2 (transforming acidic coiled-coil protein 2) in breast
            carcinoma as a potent prognostic predictor associated with cell
            proliferation
  JOURNAL   Cancer Med 5 (8), 1973-1982 (2016)
   PUBMED   27333920
  REMARK    GeneRIF: These results suggest that TACC2 plays an important role
            in the cell proliferation of breast carcinoma and therefore
            immunohistochemical TACC2 status is a candidate of worse prognostic
            factor in breast cancer cases.
REFERENCE   4  (bases 1 to 9704)
  AUTHORS   Luo X, Pan J, Wang L, Wang P, Zhang M, Liu M, Dong Z, Meng Q, Tao
            X, Zhao X, Zhong J, Ju W, Gu Y, Jenkins EC, Brown WT, Shi Q and
            Zhong N.
  TITLE     Epigenetic regulation of lncRNA connects ubiquitin-proteasome
            system with infection-inflammation in preterm births and preterm
            premature rupture of membranes
  JOURNAL   BMC Pregnancy Childbirth 15, 35 (2015)
   PUBMED   25884766
  REMARK    GeneRIF: Differential expression of the transcripts TACC2 connects
            ubiquitin-proteasome system with infection-inflammation in preterm
            births and preterm premature rupture of membranes.
            Publication Status: Online-Only
REFERENCE   5  (bases 1 to 9704)
  AUTHORS   Comuzzie AG, Cole SA, Laston SL, Voruganti VS, Haack K, Gibbs RA
            and Butte NF.
  TITLE     Novel genetic loci identified for the pathophysiology of childhood
            obesity in the Hispanic population
  JOURNAL   PLoS ONE 7 (12), e51954 (2012)
   PUBMED   23251661
REFERENCE   6  (bases 1 to 9704)
  AUTHORS   Gergely F, Karlsson C, Still I, Cowell J, Kilmartin J and Raff JW.
  TITLE     The TACC domain identifies a family of centrosomal proteins that
            can interact with microtubules
  JOURNAL   Proc. Natl. Acad. Sci. U.S.A. 97 (26), 14352-14357 (2000)
   PUBMED   11121038
REFERENCE   7  (bases 1 to 9704)
  AUTHORS   Chen HM, Schmeichel KL, Mian IS, Lelievre S, Petersen OW and
            Bissell MJ.
  TITLE     AZU-1: a candidate breast tumor suppressor and biomarker for tumor
            progression
  JOURNAL   Mol. Biol. Cell 11 (4), 1357-1367 (2000)
   PUBMED   10749935
REFERENCE   8  (bases 1 to 9704)
  AUTHORS   Gergely F, Kidd D, Jeffers K, Wakefield JG and Raff JW.
  TITLE     D-TACC: a novel centrosomal protein required for normal spindle
            function in the early Drosophila embryo
  JOURNAL   EMBO J. 19 (2), 241-252 (2000)
   PUBMED   10637228
REFERENCE   9  (bases 1 to 9704)
  AUTHORS   Still IH, Hamilton M, Vince P, Wolfman A and Cowell JK.
  TITLE     Cloning of TACC1, an embryonically expressed, potentially
            transforming coiled coil containing gene, from the 8p11 breast
            cancer amplicon
  JOURNAL   Oncogene 18 (27), 4032-4038 (1999)
   PUBMED   10435627
REFERENCE   10 (bases 1 to 9704)
  AUTHORS   Still IH, Vince P and Cowell JK.
  TITLE     The third member of the transforming acidic coiled coil-containing
            gene family, TACC3, maps in 4p16, close to translocation
            breakpoints in multiple myeloma, and is upregulated in various
            cancer cell lines
  JOURNAL   Genomics 58 (2), 165-170 (1999)
   PUBMED   10366448
COMMENT     REVIEWED REFSEQ: This record has been curated by NCBI staff. The
            reference sequence was derived from AL731566.7, AC063960.10 and
            AL135793.13.
            On Nov 23, 2018 this sequence version replaced NM_206862.3.
            
            Summary: Transforming acidic coiled-coil proteins are a conserved
            family of centrosome- and microtubule-interacting proteins that are
            implicated in cancer. This gene encodes a protein that concentrates
            at centrosomes throughout the cell cycle. This gene lies within a
            chromosomal region associated with tumorigenesis. Expression of
            this gene is induced by erythropoietin and is thought to affect the
            progression of breast tumors. Several transcript variants encoding
            different isoforms have been found for this gene. [provided by
            RefSeq, Jul 2008].
            
            Transcript Variant: This variant (1) represents the longest
            transcript and encodes the longest isoform (a). Isoform a has also
            been called the 'long' isoform.
            
            Sequence Note: This RefSeq record was created from transcript and
            genomic sequence data to make the sequence consistent with the
            reference genome assembly. The genomic coordinates used for the
            transcript record were based on transcript alignments.
            
            Publication Note:  This RefSeq record includes a subset of the
            publications that are available for this gene. Please see the Gene
            record to access additional publications.
            
            ##Evidence-Data-START##
            Transcript exon combination :: AF528099.1 [ECO:0000332]
            RNAseq introns              :: mixed/partial sample support
                                           SAMEA1965299, SAMEA1966682
                                           [ECO:0000350]
            ##Evidence-Data-END##
            
            ##RefSeq-Attributes-START##
            MANE Ensembl match     :: ENST00000369005.6/ ENSP00000358001.1
            RefSeq Select criteria :: based on conservation
            ##RefSeq-Attributes-END##
            COMPLETENESS: full length.
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-326               AL731566.7         98120-98445
            327-404             AC063960.10        167629-167706       c
            405-517             AC063960.10        139093-139205       c
            518-5830            AC063960.10        101684-106996       c
            5831-5944           AC063960.10        101052-101165       c
            5945-6070           AC063960.10        56909-57034         c
            6071-6205           AC063960.10        45937-46071         c
            6206-6342           AL135793.13        37085-37221
            6343-7654           AL135793.13        52442-53753
            7655-7715           AL135793.13        57436-57496
            7716-7917           AL135793.13        58672-58873
            7918-7979           AL135793.13        66771-66832
            7980-8095           AL135793.13        68411-68526
            8096-8267           AL135793.13        69882-70053
            8268-8408           AL135793.13        71391-71531
            8409-8498           AL135793.13        72396-72485
            8499-8642           AL135793.13        79440-79583
            8643-8719           AL135793.13        80006-80082
            8720-8763           AL135793.13        84003-84046
            8764-8924           AL135793.13        90688-90848
            8925-9031           AL135793.13        91095-91201
            9032-9152           AL135793.13        91589-91709
            9153-9704           AL135793.13        96036-96587
FEATURES             Location/Qualifiers
     source          1..9704
                     /organism="Homo sapiens"
                     /mol_type="mRNA"
                     /db_xref="taxon:9606"
                     /chromosome="10"
                     /map="10q26.13"
     gene            1..9704
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /note="transforming acidic coiled-coil containing protein
                     2"
                     /db_xref="GeneID:10579"
                     /db_xref="HGNC:HGNC:11523"
                     /db_xref="MIM:605302"
     exon            1..326
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /inference="alignment:Splign:2.1.0"
     variation       1
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1590805503"
     variation       5
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:115821605"
     variation       13
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:747252814"
     variation       20
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1049590222"
     variation       21
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1442932916"
     variation       25
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1052094273"
     variation       34
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1443487797"
     variation       46
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:371604800"
     variation       47
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:890929596"
     variation       48
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1565009708"
     variation       60
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1320093803"
     variation       61
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1010580459"
     variation       62
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1022030967"
     variation       66
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1305742010"
     variation       70
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1565009755"
     variation       77
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1008056453"
     variation       79
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:192099598"
     variation       90
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:771241346"
     variation       92
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1191685891"
     variation       95
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1469597387"
     variation       104
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:56264039"
     variation       109
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:955121621"
     variation       116..117
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace=""
                     /replace="aa"
                     /db_xref="dbSNP:1484717218"
     variation       123
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1261940059"
     variation       124
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:548916172"
     variation       125
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:7900585"
     variation       127
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1590805681"
     variation       129
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1276819310"
     variation       138
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1237183735"
     variation       147
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1372119388"
     variation       149
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1032317071"
     variation       150
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:2420980"
     variation       164
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2901298"
     variation       167
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:973387312"
     variation       171
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1025108934"
     variation       172
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1465556939"
     variation       173
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:970907229"
     variation       175
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1395433112"
     variation       176..181
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="tttttt"
                     /replace="ttttttt"
                     /db_xref="dbSNP:1455550811"
     variation       179
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1463936968"
     variation       181
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:374260725"
     variation       188
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1247028860"
     variation       191
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1426367887"
     variation       192
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:948188297"
     variation       193
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:908316190"
     variation       195
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:981013029"
     variation       198
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:776072316"
     variation       201
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:961123404"
     variation       203
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1216034397"
     variation       210
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1482619946"
     variation       213..214
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace=""
                     /replace="tt"
                     /db_xref="dbSNP:927855191"
     variation       215
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:570687354"
     variation       216
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1052311422"
     variation       231
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1274364120"
     variation       236
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1590805851"
     variation       245
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:762564570"
     variation       246
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:572808375"
     variation       249..254
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="tttttt"
                     /replace="ttttttt"
                     /db_xref="dbSNP:1043421301"
     variation       250
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:899577667"
     variation       255
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:932569076"
     variation       267
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:553270419"
     variation       276
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:751235609"
     variation       277
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1343160232"
     variation       278
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1462970569"
     variation       280
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:566785052"
     variation       292
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:890587664"
     variation       307
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:912481480"
     variation       309
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1460228901"
     variation       315
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:943876036"
     variation       319
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1009037273"
     variation       320
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:368131504"
     variation       322
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1375882895"
     variation       325
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1042233058"
     variation       326
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:761492335"
     exon            327..404
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /inference="alignment:Splign:2.1.0"
     variation       328
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:896720881"
     variation       330
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:759136137"
     variation       331
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:756798875"
     variation       333
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:745326586"
     variation       334
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1173514668"
     variation       336
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:755669282"
     variation       343
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:780679760"
     variation       346
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1320471019"
     variation       347
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200528686"
     variation       351
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:372926797"
     variation       352
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:151268273"
     variation       353
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1451117201"
     variation       356
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:774802156"
     variation       357
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1368679552"
     misc_feature    363..365
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /note="upstream in-frame stop codon"
     variation       370
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:368424069"
     variation       371
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:376941035"
     CDS             372..9218
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /note="isoform a is encoded by transcript variant 1; anti
                     zuai-1"
                     /codon_start=1
                     /product="transforming acidic coiled-coil-containing
                     protein 2 isoform a"
                     /protein_id="NP_996744.4"
                     /db_xref="CCDS:CCDS7626.1"
                     /db_xref="GeneID:10579"
                     /db_xref="HGNC:HGNC:11523"
                     /db_xref="MIM:605302"
                     /translation="
MGNENSTSDNQRTLSAQTPRSAQPPGNSQNIKRKQQDTPGSPDHRDASSIGSVGLGGFCTASESSASLDPCLVSPEVTEPRKDPQGARGPEGSLLPSPPPSQEREHPSSSMPFAECPPEGCLASPAAAPEDGPQTQSPRREPAPNAPGDIAAAFPAERDSSTPYQEIAAVPSAGRERQPKEEGQKSSFSFSSGIDQSPGMSPVPLREPMKAPLCGEGDQPGGFESQEKEAAGGFPPAESRQGVASVQVTPEAPAAAQQGTESSAVLEKSPLKPMAPIPQDPAPRASDRERGQGEAPPQYLTDDLEFLRACHLPRSNSGAAPEAEVNAASQESCQQPVGAYLPHAELPWGLPSPALVPEAGGSGKEALDTIDVQGHPQTGMRGTKPNQVVCVAAGGQPEGGLPVSPEPSLLTPTEEAHPASSLASFPAAQIPIAVEEPGSSSRESVSKAGMPVSADAAKEVVDAGLVGLERQVSDLGSKGEHPEGDPGEVPAPSPQERGEHLNTEQSHEVQPGVPPPPLPKEQSHEVQPGAPPPPLPKAPSESARGPPGPTDGAKVHEDSTSPAVAKEGSRSPGDSPGGKEEAPEPPDGGDPGNLQGEDSQAFSSKRDPEVGKDELSKPSSDAESRDHPSSHSAQPPRKGGAGHTDGPHSQTAEADASGLPHKLGEEDPVLPPVPDGAGEPTVPEGAIWEGSGLQPKCPDTLQSREGLGRMESFLTLESEKSDFPPTPVAEVAPKAQEGESTLEIRKMGSCDGEGLLTSPDQPRGPACDASRQEFHAGVPHPPQGENLAADLGLTALILDQDQQGIPSCPGEGWIRGAASEWPLLSSEKHLQPSQAQPETSIFDVLKEQAQPPENGKETSPSHPGFKDQGADSSQIHVPVEPQEDNNLPTHGGQEQALGSELQSQLPKGTLSDTPTSSPTDMVWESSLTEESELSAPTRQKLPALGEKRPEGACGDGQSSRVSPPAADVLKDFSLAGNFSRKETCCTGQGPNKSQQALADALEEGSQHEEACQRHPGASEAADGCSPLWGLSKREMASGNTGEAPPCQPDSVALLDAVPCLPALAPASPGVTPTQDAPETEACDETQEGRQQPVPAPQQKMECWATSDAESPKLLASFPSAGEQGGEAGAAETGGSAGAGDPGKQQAPEKPGEATLSCGLLQTEHCLTSGEEASTSALRESCQAEHPMASCQDALLPARELGGIPRSTMDFSTHQAVPDPKELLLSGPPEVAAPDTPYLHVDSAAQRGAEDSGVKAVSSADPRAPGESPCPVGEPPLALENAASLKLFAGSLAPLLQPGAAGGEIPAVQASSGSPKARTTEGPVDSMPCLDRMPLLAKGKQATGEEKAATAPGAGAKASGEGMAGDAAGETEGSMERMGEPSQDPKQGTSGGVDTSSEQIATLTGFPDFREHIAKIFEKPVLGALATPGEKAGAGRSAVGKDLTRPLGPEKLLDGPPGVDVTLLPAPPARLQVEKKQQLAGEAEISHLALQDPASDKLLGPAGLTWERNLPGAGVGKEMAGVPPTLREDERPEGPGAAWPGLEGQAYSQLERSRQELASGLPSPAATQELPVERAAAFQVAPHSHGEEAVAQDRIPSGKQHQETSACDSPHGEDGPGDFAHTGVPGHVPRSTCAPSPQREVLTVPEANSEPWTLDTLGGERRPGVTAGILEMRNALGNQSTPAPPTGEVADTPLEPGKVAGAAGEAEGDITLSTAETQACASGDLPEAGTTRTFSVVAGDLVLPGSCQDPACSDKAPGMEGTAALHGDSPARPQQAKEQPGPERPIPAGDGKVCVSSPPEPDETHDPKLQHLAPEELHTDRESPRPGPSMLPSVPKKDAPRVMDKVTSDETRGAEGTESSPVADDIIQPAAPADLESPTLAASSYHGDVVGQVSTDLIAQSISPAAAHAGLPPSAAEHIVSPSAPAGDRVEASTPSCPDPAKDLSRSSDSEEAFETPESTTPVKAPPAPPPPPPEVIPEPEVSTQPPPEEPGCGSETVPVPDGPRSDSVEGSPFRPPSHSFSAVFDEDKPIASSGTYNLDFDNIELVDTFQTLEPRASDAKNQEGKVNTRRKSTDSVPISKSTLSRSLSLQASDFDGASSSGNPEAVALAPDAYSTGSSSASSTLKRTKKPRPPSLKKKQTTKKPTETPPVKETQQEPDEESLVPSGENLASETKTESAKTEGPSPALLEETPLEPAVGPKAACPLDSESAEGVVPPASGGGRVQNSPPVGRKTLPLTTAPEAGEVTPSDSGGQEDSPAKGLSVRLEFDYSEDKSSWDNQQENPPPTKKIGKKPVAKMPLRRPKMKKTPEKLDNTPASPPRSPAEPNDIPIAKGTYTFDIDKWDDPNFNPFSSTSKMQESPKLPQQSYNFDPDTCDESVDPFKTSSKTPSSPSKSPASFEIPASAMEANGVDGDGLNKPAKKKKTPLKTDTFRVKKSPKRSPLSDPPSQDPTPAATPETPPVISAVVHATDEEKLAVTNQKWTCMTVDLEADKQDYPQPSDLSTFVNETKFSSPTEELDYRNSYEIEYMEKIGSSLPQDDDAPKKQALYLMFDTSQESPVKSSPVRMSESPTPCSGSSFEETEALVNTAAKNQHPVPRGLAPNQESHLQVPEKSSQKELEAMGLGTPSEAIEITAPEGSFASADALLSRLAHPVSLCGALDYLEPDLAEKNPPLFAQKLQEELEFAIMRIEALKLARQIALASRSHQDAKREAAHPTDVSISKTALYSRIGTAEVEKPAGLLFQQPDLDSALQIARAEIITKEREVSEWKDKYEESRREVMEMRKIVAEYEKTIAQMIEDEQREKSVSHQTVQQLVLEKEQALADLNSVEKSLADLFRRYEKMKEVLEGFRKNEEVLKRCAQEYLSRVKKEEQRYQALKVHAEEKLDRANAEIAQVRGKAQQEQAAHQASLRKEQLRVDALERTLEQKNKEIEELTKICDELIAKMGKS"
     misc_feature    <414..1775
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /note="Atrophin-1 family; Region: Atrophin-1; cl26464"
                     /db_xref="CDD:331285"
     misc_feature    960..962
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /note="Phosphoserine.
                     /evidence=ECO:0000244|PubMed:18669648,
                     ECO:0000244|PubMed:20068231; propagated from
                     UniProtKB/Swiss-Prot (O95359.3); phosphorylation site"
     misc_feature    972..974
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /note="Phosphoserine.
                     /evidence=ECO:0000244|PubMed:18669648,
                     ECO:0000244|PubMed:20068231; propagated from
                     UniProtKB/Swiss-Prot (O95359.3); phosphorylation site"
     misc_feature    1176..1178
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /note="Phosphoserine.
                     /evidence=ECO:0000244|PubMed:20068231; propagated from
                     UniProtKB/Swiss-Prot (O95359.3); phosphorylation site"
     misc_feature    1344..1346
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /note="Phosphothreonine.
                     /evidence=ECO:0000244|PubMed:18669648; propagated from
                     UniProtKB/Swiss-Prot (O95359.3); phosphorylation site"
     misc_feature    1848..1850
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /note="Phosphoserine.
                     /evidence=ECO:0000244|PubMed:20068231; propagated from
                     UniProtKB/Swiss-Prot (O95359.3); phosphorylation site"
     misc_feature    2052..2054
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /note="Phosphoserine.
                     /evidence=ECO:0000244|PubMed:20068231; propagated from
                     UniProtKB/Swiss-Prot (O95359.3); phosphorylation site"
     misc_feature    2082..2084
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /note="Phosphoserine.
                     /evidence=ECO:0000244|PubMed:18669648; propagated from
                     UniProtKB/Swiss-Prot (O95359.3); phosphorylation site"
     misc_feature    2094..2096
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /note="Phosphoserine.
                     /evidence=ECO:0000244|PubMed:18669648; propagated from
                     UniProtKB/Swiss-Prot (O95359.3); phosphorylation site"
     misc_feature    2643..2645
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /note="Phosphoserine.
                     /evidence=ECO:0000244|PubMed:18669648; propagated from
                     UniProtKB/Swiss-Prot (O95359.3); phosphorylation site"
     misc_feature    3255..3257
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /note="Phosphoserine.
                     /evidence=ECO:0000244|PubMed:18669648; propagated from
                     UniProtKB/Swiss-Prot (O95359.3); phosphorylation site"
     misc_feature    3444..3446
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /note="Phosphoserine.
                     /evidence=ECO:0000244|PubMed:18669648; propagated from
                     UniProtKB/Swiss-Prot (O95359.3); phosphorylation site"
     misc_feature    4170..4172
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /note="Phosphoserine.
                     /evidence=ECO:0000244|PubMed:18669648; propagated from
                     UniProtKB/Swiss-Prot (O95359.3); phosphorylation site"
     misc_feature    4308..4310
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /note="Phosphoserine.
                     /evidence=ECO:0000244|PubMed:18669648; propagated from
                     UniProtKB/Swiss-Prot (O95359.3); phosphorylation site"
     misc_feature    <4938..6332
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /note="Atrophin-1 family; Region: Atrophin-1; cl26464"
                     /db_xref="CDD:331285"
     misc_feature    5055..5057
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /note="Phosphoserine.
                     /evidence=ECO:0000244|PubMed:18669648; propagated from
                     UniProtKB/Swiss-Prot (O95359.3); phosphorylation site"
     misc_feature    6585..6587
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /note="Phosphoserine.
                     /evidence=ECO:0000244|PubMed:18669648,
                     ECO:0000244|PubMed:21406692, ECO:0000244|PubMed:24275569;
                     propagated from UniProtKB/Swiss-Prot (O95359.3);
                     phosphorylation site"
     misc_feature    6852..6854
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /note="Phosphoserine.
                     /evidence=ECO:0000250|UniProtKB:Q9JJG0; propagated from
                     UniProtKB/Swiss-Prot (O95359.3); phosphorylation site"
     misc_feature    7047..7049
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /note="Phosphoserine.
                     /evidence=ECO:0000244|PubMed:20068231,
                     ECO:0000244|PubMed:24275569; propagated from
                     UniProtKB/Swiss-Prot (O95359.3); phosphorylation site"
     misc_feature    7107..7109
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /note="Phosphothreonine.
                     /evidence=ECO:0000244|PubMed:18669648,
                     ECO:0000244|PubMed:20068231; propagated from
                     UniProtKB/Swiss-Prot (O95359.3); phosphorylation site"
     misc_feature    7137..7139
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /note="Phosphoserine.
                     /evidence=ECO:0000244|PubMed:16964243,
                     ECO:0000244|PubMed:18669648, ECO:0000244|PubMed:20068231,
                     ECO:0000244|PubMed:21406692, ECO:0000244|PubMed:23186163;
                     propagated from UniProtKB/Swiss-Prot (O95359.3);
                     phosphorylation site"
     misc_feature    7320..7322
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /note="Phosphoserine.
                     /evidence=ECO:0000244|PubMed:17081983,
                     ECO:0000244|PubMed:18669648, ECO:0000244|PubMed:20068231,
                     ECO:0000244|PubMed:21406692, ECO:0000244|PubMed:23186163,
                     ECO:0000244|PubMed:24275569; propagated from
                     UniProtKB/Swiss-Prot (O95359.3); phosphorylation site"
     misc_feature    7332..7334
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /note="Phosphoserine.
                     /evidence=ECO:0000244|PubMed:17081983,
                     ECO:0000244|PubMed:18669648, ECO:0000244|PubMed:20068231,
                     ECO:0000244|PubMed:21406692; propagated from
                     UniProtKB/Swiss-Prot (O95359.3); phosphorylation site"
     misc_feature    7446..7448
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /note="Phosphoserine.
                     /evidence=ECO:0000244|PubMed:18669648; propagated from
                     UniProtKB/Swiss-Prot (O95359.3); phosphorylation site"
     misc_feature    7536..7538
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /note="Phosphoserine.
                     /evidence=ECO:0000244|PubMed:18669648; propagated from
                     UniProtKB/Swiss-Prot (O95359.3); phosphorylation site"
     misc_feature    7545..7547
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /note="Phosphoserine.
                     /evidence=ECO:0000250|UniProtKB:Q9JJG0; propagated from
                     UniProtKB/Swiss-Prot (O95359.3); phosphorylation site"
     misc_feature    7551..7553
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /note="Phosphoserine.
                     /evidence=ECO:0000244|PubMed:18669648; propagated from
                     UniProtKB/Swiss-Prot (O95359.3); phosphorylation site"
     misc_feature    7578..7580
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /note="Phosphoserine.
                     /evidence=ECO:0000244|PubMed:18669648; propagated from
                     UniProtKB/Swiss-Prot (O95359.3); phosphorylation site"
     misc_feature    7659..7661
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /note="Phosphothreonine.
                     /evidence=ECO:0000244|PubMed:23186163; propagated from
                     UniProtKB/Swiss-Prot (O95359.3); phosphorylation site"
     misc_feature    7722..7724
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /note="Phosphothreonine.
                     /evidence=ECO:0000244|PubMed:20068231; propagated from
                     UniProtKB/Swiss-Prot (O95359.3); phosphorylation site"
     misc_feature    7734..7736
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /note="Phosphothreonine.
                     /evidence=ECO:0000244|PubMed:20068231; propagated from
                     UniProtKB/Swiss-Prot (O95359.3); phosphorylation site"
     misc_feature    7743..7745
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /note="Phosphothreonine.
                     /evidence=ECO:0000244|PubMed:20068231; propagated from
                     UniProtKB/Swiss-Prot (O95359.3); phosphorylation site"
     misc_feature    7905..7907
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /note="Phosphoserine.
                     /evidence=ECO:0000244|PubMed:16964243,
                     ECO:0000244|PubMed:18669648, ECO:0000244|PubMed:20068231,
                     ECO:0000244|PubMed:23186163; propagated from
                     UniProtKB/Swiss-Prot (O95359.3); phosphorylation site"
     misc_feature    7971..7973
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /note="Phosphoserine.
                     /evidence=ECO:0000244|PubMed:23186163; propagated from
                     UniProtKB/Swiss-Prot (O95359.3); phosphorylation site"
     misc_feature    8028..8030
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /note="Phosphothreonine.
                     /evidence=ECO:0000250|UniProtKB:Q9JJG0; propagated from
                     UniProtKB/Swiss-Prot (O95359.3); phosphorylation site"
     misc_feature    8040..8042
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /note="Phosphoserine.
                     /evidence=ECO:0000244|PubMed:20068231; propagated from
                     UniProtKB/Swiss-Prot (O95359.3); phosphorylation site"
     misc_feature    8076..8078
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /note="Phosphoserine.
                     /evidence=ECO:0000244|PubMed:23186163; propagated from
                     UniProtKB/Swiss-Prot (O95359.3); phosphorylation site"
     misc_feature    8244..8246
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /note="Phosphothreonine.
                     /evidence=ECO:0000244|PubMed:18669648; propagated from
                     UniProtKB/Swiss-Prot (O95359.3); phosphorylation site"
     misc_feature    8595..9197
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /note="Transforming acidic coiled-coil-containing protein
                     (TACC); Region: TACC; pfam05010"
                     /db_xref="CDD:309929"
     variation       373
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1349609278"
     variation       381
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1384553919"
     variation       383
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1203183802"
     variation       384..385
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="aa"
                     /replace="aaa"
                     /db_xref="dbSNP:1269775765"
     variation       392
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1215968267"
     variation       394
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:547823080"
     variation       395
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:886895560"
     variation       397
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1283714338"
     variation       399
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1212493882"
     variation       400
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:773505492"
     exon            405..517
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /inference="alignment:Splign:2.1.0"
     variation       406
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:192689513"
     variation       407
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1375461398"
     variation       411
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1307737191"
     variation       419
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:754559620"
     variation       423
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:779540446"
     variation       424
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:753289073"
     variation       426
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:756120822"
     variation       429
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1173681722"
     variation       430
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:758684627"
     variation       434
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:114344239"
     variation       435
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:202197379"
     variation       436
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="ccctc"
                     /db_xref="dbSNP:748791718"
     variation       436
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:138166528"
     variation       437
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:745896242"
     variation       440
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:769907900"
     variation       443
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1591469852"
     variation       446
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:774154821"
     variation       447
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:761870489"
     variation       448
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:771921628"
     variation       453
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:375973608"
     variation       454
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201980895"
     variation       456
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1238814181"
     variation       457
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:766081390"
     variation       462
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace=""
                     /replace="a"
                     /db_xref="dbSNP:1591470042"
     variation       462
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:369830070"
     variation       463
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1554980725"
     variation       464..468
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="aaaa"
                     /replace="aaaaa"
                     /db_xref="dbSNP:753443406"
     variation       465
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:759087516"
     variation       470
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:370111299"
     variation       472
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:764868224"
     variation       473
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:115077750"
     variation       475
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:758882459"
     variation       484
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:540521848"
     variation       485
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:751908069"
     variation       487
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1158155825"
     variation       488..489
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace=""
                     /replace="t"
                     /db_xref="dbSNP:763342425"
     variation       488
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:577387065"
     variation       489
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:573681653"
     variation       495
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200691895"
     variation       500
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1352400701"
     variation       502
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1320631404"
     variation       504
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1393009319"
     variation       509
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:140883324"
     variation       510
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:780126824"
     variation       511
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:749336283"
     variation       512
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:11200367"
     variation       513
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:760524024"
     variation       515
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1331467958"
     variation       516
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1229314757"
     variation       517
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1272791539"
     exon            518..5830
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /inference="alignment:Splign:2.1.0"
     variation       520
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:138597000"
     variation       522
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1372977281"
     variation       524
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:952513086"
     variation       526
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:968854951"
     variation       527
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:369866874"
     variation       528
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:769447853"
     variation       531
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1450537702"
     variation       533
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1401814880"
     variation       537
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:539346663"
     variation       538
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:138796945"
     variation       540
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1226301817"
     variation       541
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:763550115"
     variation       542
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:774831593"
     variation       545
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1437030329"
     variation       546
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1205587179"
     variation       549
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1591801823"
     variation       550
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1277726271"
     variation       551
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:762252775"
     variation       552
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:115572080"
     variation       554
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1237711421"
     variation       557
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:750751342"
     variation       561
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1186166664"
     variation       562
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1335659286"
     variation       566
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1392544523"
     variation       572
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1450701880"
     variation       575
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1173397369"
     variation       582
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:191313839"
     variation       584
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:756461782"
     variation       585
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:754047980"
     variation       587
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:182633225"
     variation       590
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1344864902"
     variation       593
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:779193768"
     variation       594
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:748251065"
     variation       596
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:757192262"
     variation       607
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:781309215"
     variation       612
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:574835006"
     variation       614
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:769522022"
     variation       619
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace=""
                     /replace="a"
                     /db_xref="dbSNP:1485880225"
     variation       621
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1220763436"
     variation       623
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:201040329"
     variation       624
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1464196742"
     variation       625
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:777133517"
     variation       627
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:866845498"
     variation       630
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:139133884"
     variation       631
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:143057039"
     variation       635
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:773786012"
     variation       637
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:761348528"
     variation       638
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:772523083"
     variation       639..640
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="cc"
                     /db_xref="dbSNP:1228306033"
     variation       644
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:773759070"
     variation       646
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:761069382"
     variation       647
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:766722368"
     variation       662
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:754078377"
     variation       663
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1307904014"
     variation       667
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="ccgc"
                     /db_xref="dbSNP:1161463614"
     variation       667
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:532147977"
     variation       668
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1565235917"
     variation       670
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:369387017"
     variation       671
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:373182521"
     variation       675
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1329310218"
     variation       679
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:200671128"
     variation       681
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:377057058"
     variation       682
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:781250337"
     variation       684
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1035710398"
     variation       685
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:750363676"
     variation       687
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:898091499"
     variation       689
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:755931307"
     variation       691
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:375164406"
     variation       694
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:141987188"
     variation       695
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201984659"
     variation       696
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:778562836"
     variation       697
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1591803099"
     variation       700
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1202231209"
     variation       701
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:747638919"
     variation       702
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1453887168"
     variation       703
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1200011504"
     variation       704
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:771610804"
     variation       707
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:773704307"
     variation       708
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:199673873"
     variation       713
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1182894618"
     variation       714
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:373788566"
     variation       716
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1460951688"
     variation       717
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1161584714"
     variation       719
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1388467605"
     variation       720
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:147458352"
     variation       723
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1324127475"
     variation       724
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:376962666"
     variation       725
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:139828953"
     variation       729
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:763092038"
     variation       731
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:142984046"
     variation       732
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:755940383"
     variation       736
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1263231461"
     variation       739
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1461610469"
     variation       744
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1478832013"
     variation       748
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1359072315"
     variation       749
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1591803627"
     variation       751
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:528115484"
     variation       752
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:753531775"
     variation       754
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1482252348"
     variation       755
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:754820367"
     variation       761
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:778507311"
     variation       762
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1471076806"
     variation       763
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1423514696"
     variation       765..766
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="gg"
                     /db_xref="dbSNP:1185497500"
     variation       765
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1233315473"
     variation       767
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1370193834"
     variation       769..771
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="ctc"
                     /db_xref="dbSNP:752075521"
     variation       772
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1164077070"
     variation       773
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:747863916"
     variation       775
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1427545282"
     variation       776
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1198091564"
     variation       781
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:907693838"
     variation       782
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1309677133"
     variation       791
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:771559274"
     variation       792
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:547871776"
     variation       793
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:746532477"
     variation       795
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1341684181"
     variation       796
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1244916642"
     variation       799..802
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="cccc"
                     /replace="ccccc"
                     /db_xref="dbSNP:757693244"
     variation       800
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1297465705"
     variation       803
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:771302189"
     variation       804
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:963734438"
     variation       807
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1309046698"
     variation       809
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:777216753"
     variation       810
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1328109752"
     variation       812
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1215691127"
     variation       814
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:746213186"
     variation       820
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1283912221"
     variation       821
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:770318243"
     variation       822
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1198883792"
     variation       823
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:78149003"
     variation       824
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:774257197"
     variation       826
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:139910468"
     variation       827
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:774962316"
     variation       828
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:753858328"
     variation       835
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1170249935"
     variation       836
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:149820575"
     variation       837
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:765076181"
     variation       839
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1300665813"
     variation       849
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1403948166"
     variation       853
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:146707567"
     variation       854..857
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="tact"
                     /replace="tacttact"
                     /db_xref="dbSNP:781399781"
     variation       854
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:41288000"
     variation       855
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:370732959"
     variation       857
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:763800934"
     variation       858
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:781519455"
     variation       859
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:746440335"
     variation       863..864
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="cc"
                     /db_xref="dbSNP:750447544"
     variation       864
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:770267070"
     variation       865
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:144016066"
     variation       869
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1483728396"
     variation       870
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1468971932"
     variation       872
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:749704333"
     variation       875..889
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="tgc"
                     /replace="tgccgtccccagtgc"
                     /db_xref="dbSNP:1241686627"
     variation       878
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:146425124"
     variation       879
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:11200385"
     variation       885
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1285355053"
     variation       886
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:767703887"
     variation       887
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:776420572"
     variation       894..902
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="agagaga"
                     /replace="agagagaga"
                     /db_xref="dbSNP:1432349259"
     variation       897
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1173746849"
     variation       903
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:759412867"
     variation       904
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1591805162"
     variation       907
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:765166194"
     variation       908
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:752447470"
     variation       912..918
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="gaag"
                     /replace="gaagaag"
                     /db_xref="dbSNP:1385726721"
     variation       912
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:763630843"
     variation       917
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:946315751"
     variation       918
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:199693945"
     variation       921
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:756712964"
     variation       922
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:780809477"
     variation       925
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1303938289"
     variation       926
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1312994030"
     variation       929..944
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="ctccttctccttctcc"
                     /replace="ctccttctccttctccttctcc"
                     /db_xref="dbSNP:756169189"
     variation       929
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:535065792"
     variation       931
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:756620419"
     variation       932..936
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="ct"
                     /replace="cttct"
                     /db_xref="dbSNP:780453024"
     variation       934
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1372806087"
     variation       935..939
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="ct"
                     /replace="ctcct"
                     /db_xref="dbSNP:904541826"
     variation       935
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1056487135"
     variation       937..938
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="cc"
                     /db_xref="dbSNP:1331262700"
     variation       937
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:780732675"
     variation       938..942
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="ct"
                     /replace="cttct"
                     /db_xref="dbSNP:749452283"
     variation       942
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:749651425"
     variation       943
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:769108695"
     variation       945
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:996551474"
     variation       947
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:779002808"
     variation       953
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:559804804"
     variation       955
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1418935659"
     variation       960
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:772197780"
     variation       963..964
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="cc"
                     /db_xref="dbSNP:1480646280"
     variation       963
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1180939566"
     variation       972
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:773211037"
     variation       973
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1458329823"
     variation       974
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1159256265"
     variation       975
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1210607758"
     variation       979
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:760776569"
     variation       981
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1456902268"
     variation       988
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1484897417"
     variation       996
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:554657489"
     variation       1000
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1212250186"
     variation       1002
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:775453520"
     variation       1004
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace=""
                     /replace="a"
                     /db_xref="dbSNP:768582523"
     variation       1005
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:764016618"
     variation       1006
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201276537"
     variation       1007
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:761467777"
     variation       1008
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1412639970"
     variation       1010
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:767078887"
     variation       1017
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:772816568"
     variation       1021
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:749906694"
     variation       1023
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:143195709"
     variation       1025
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1490439884"
     variation       1026
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1204226690"
     variation       1027
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:887986265"
     variation       1029
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1591806245"
     variation       1030
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1357167335"
     variation       1033
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:780679682"
     variation       1034
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:754467303"
     variation       1036
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:374397256"
     variation       1042
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1187512168"
     variation       1043
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1474401079"
     variation       1044
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1412361944"
     variation       1045
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:779280100"
     variation       1049
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:543513548"
     variation       1052
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:772300166"
     variation       1058
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1429480913"
     variation       1060
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:777991788"
     variation       1061
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:747068095"
     variation       1062
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:367976637"
     variation       1067
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1591806585"
     variation       1072
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1307587628"
     variation       1073
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1283831210"
     variation       1074
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:775402055"
     variation       1076
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1357019026"
     variation       1077
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1230128352"
     variation       1078
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:763000875"
     variation       1079
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace=""
                     /replace="t"
                     /db_xref="dbSNP:1565239223"
     variation       1079
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:768487816"
     variation       1080
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1360133978"
     variation       1086
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1390662729"
     variation       1087
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1371086694"
     variation       1092
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:963804882"
     variation       1093
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1202928711"
     variation       1094..1098
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="gggg"
                     /replace="ggggg"
                     /db_xref="dbSNP:1227375547"
     variation       1095
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1401149550"
     variation       1096
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:961816829"
     variation       1098
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:774125717"
     variation       1103
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:761541862"
     variation       1110
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:767259677"
     variation       1111
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:151218566"
     variation       1113
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:201513169"
     variation       1120
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1241727330"
     variation       1121
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1386387813"
     variation       1124
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1449454104"
     variation       1125
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:370529132"
     variation       1126..1129
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="cccc"
                     /replace="ccccc"
                     /db_xref="dbSNP:778835852"
     variation       1133
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1167097911"
     variation       1134
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:753305212"
     variation       1135..1152
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="cag"
                     /replace="cagcccagcagggcacag"
                     /db_xref="dbSNP:748180148"
     variation       1138
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1591807332"
     variation       1143
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:374044820"
     variation       1146
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:980875898"
     variation       1148
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:779322137"
     variation       1150
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:367593472"
     variation       1152
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:777936931"
     variation       1155
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:747294941"
     variation       1156
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:757312128"
     variation       1162
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:371430835"
     variation       1163
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200705484"
     variation       1168
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1227489270"
     variation       1172
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:768595912"
     variation       1175
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:956566613"
     variation       1176
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:774206095"
     variation       1177..1182
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="cccccc"
                     /replace="ccccccc"
                     /db_xref="dbSNP:1370204599"
     variation       1177
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:747945270"
     variation       1179
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:868558986"
     variation       1181
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:11816938"
     variation       1182
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1389693868"
     variation       1187
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1591807814"
     variation       1189
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1310129764"
     variation       1191
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1591807847"
     variation       1195..1198
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="ccc"
                     /replace="cccc"
                     /db_xref="dbSNP:1398024688"
     variation       1195
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:866405275"
     variation       1197
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1453441105"
     variation       1198
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:146983657"
     variation       1199
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:138069008"
     variation       1203
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:758992994"
     variation       1204
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1187170370"
     variation       1206
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1250472736"
     variation       1208
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:542065957"
     variation       1209
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1172409444"
     variation       1210
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1423311299"
     variation       1214
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1380377116"
     variation       1221
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:753182204"
     variation       1223
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1191200763"
     variation       1226
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1177423326"
     variation       1228
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:750417915"
     variation       1233..1237
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="aga"
                     /replace="agaga"
                     /db_xref="dbSNP:1387926412"
     variation       1238
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1433020020"
     variation       1242
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1318414946"
     variation       1244
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:758754668"
     variation       1245
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1431175414"
     variation       1249
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:764496827"
     variation       1250
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1365049271"
     variation       1254
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:751934143"
     variation       1255
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:143121367"
     variation       1256
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:781422767"
     variation       1258
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:150583771"
     variation       1259
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:138162632"
     variation       1260
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:778907040"
     variation       1262
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1347037820"
     variation       1265
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1050895902"
     variation       1266
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1565240698"
     variation       1267
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:550713473"
     variation       1268
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:919300435"
     variation       1269
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1479216436"
     variation       1280
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1200346563"
     variation       1285
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:772149524"
     variation       1289
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1455683413"
     variation       1295
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1161527036"
     variation       1300
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:773078761"
     variation       1303
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1387033561"
     variation       1304
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1591808732"
     variation       1312
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:929297984"
     variation       1316
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1401284240"
     variation       1320
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:746834833"
     variation       1324
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1347847504"
     variation       1326
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1324407499"
     variation       1328
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:770661570"
     variation       1332
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:776198678"
     variation       1334
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1283488236"
     variation       1336
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:759053524"
     variation       1339
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1383137398"
     variation       1340
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:149557136"
     variation       1349
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1565241088"
     variation       1352
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:776048491"
     variation       1353
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:570548726"
     variation       1355
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1209705359"
     variation       1360
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:763389378"
     variation       1362
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1455156905"
     variation       1365
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:764588961"
     variation       1371
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:751880808"
     variation       1372
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:757639386"
     variation       1375
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1471768319"
     variation       1386
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1184077085"
     variation       1387
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:767750830"
     variation       1388
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1472519482"
     variation       1396
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:770976617"
     variation       1397
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:201912981"
     variation       1398..1400
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="cac"
                     /replace="cacac"
                     /db_xref="dbSNP:1263477888"
     variation       1399
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1426288932"
     variation       1400
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:377717933"
     variation       1401
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:549925900"
     variation       1407..1437
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="ctgccctggggcttgccaagtcctgccctgg"
                     /replace="ctgccctggggcttgccaagtcctgccctggggcttgccaagtcctgc
                     cctgg"
                     /db_xref="dbSNP:771868818"
     variation       1409
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1330492288"
     variation       1410
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:552803087"
     variation       1412
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:758375476"
     variation       1424
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1591809454"
     variation       1426
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:777878485"
     variation       1431
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1282912667"
     variation       1434
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:746781383"
     variation       1438
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1247158967"
     variation       1447
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:770886696"
     variation       1454
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1482282700"
     variation       1456
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:995053150"
     variation       1458
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1197718510"
     variation       1460
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1226863673"
     variation       1466
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:780889466"
     variation       1467
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1324907028"
     variation       1468
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:566405955"
     variation       1475
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1298001733"
     variation       1476
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1185570831"
     variation       1479
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:758613158"
     variation       1480
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1007789977"
     variation       1482
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:774795630"
     variation       1485
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:762479718"
     variation       1488
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:969735887"
     variation       1490
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1389257434"
     variation       1491
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1460295396"
     variation       1493
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:980713186"
     variation       1497
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:376621212"
     variation       1499
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:535017370"
     variation       1505
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:762162854"
     variation       1511
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:901976240"
     variation       1512
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:144408700"
     variation       1513
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:760742195"
     variation       1515
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1453929654"
     variation       1516
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:866587992"
     variation       1519
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:202181318"
     variation       1520
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:753924739"
     variation       1524..1526
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="cc"
                     /replace="ccc"
                     /db_xref="dbSNP:1230121690"
     variation       1524
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1252082508"
     variation       1526
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:148794347"
     variation       1528
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:751612350"
     variation       1532
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:757057983"
     variation       1539
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1474737220"
     variation       1540
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1461837076"
     variation       1543
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:868821748"
     variation       1544
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1189862285"
     variation       1545
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:780788735"
     variation       1547
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:745676307"
     variation       1549
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1426487505"
     variation       1551
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1172330678"
     variation       1553
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:368657688"
     variation       1554
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:779778333"
     variation       1555
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:747138914"
     variation       1559
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1337545458"
     variation       1562
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:537032352"
     variation       1563
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:757642911"
     variation       1564
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1050664023"
     variation       1566..1570
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="ggg"
                     /replace="ggggg"
                     /db_xref="dbSNP:772831539"
     variation       1566
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:141547215"
     variation       1567
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:762250594"
     variation       1569
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:746392374"
     variation       1570
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:772637339"
     variation       1571
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1591810674"
     variation       1573
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:980617843"
     variation       1574
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1341585496"
     variation       1583
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1330888994"
     variation       1584
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:773412896"
     variation       1587
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:761126564"
     variation       1590
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:766491271"
     variation       1591
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:944683633"
     variation       1596
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1267403196"
     variation       1599
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:754156600"
     variation       1600
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1188044643"
     variation       1601
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1170827353"
     variation       1606
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:146365477"
     variation       1607
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1432401223"
     variation       1611
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:765463510"
     variation       1613
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:200855604"
     variation       1621
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:576922376"
     variation       1623
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:202167155"
     variation       1624
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:750136554"
     variation       1626
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:755984690"
     variation       1633
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1436111855"
     variation       1637
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:551434293"
     variation       1638
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1199400051"
     variation       1642
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:866006967"
     variation       1643
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:929354267"
     variation       1644
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:547161743"
     variation       1645
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1390404370"
     variation       1653
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1565243131"
     variation       1654
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1049107667"
     variation       1656
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1357528024"
     variation       1661
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:754640237"
     variation       1663
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:778329449"
     variation       1665
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1346442184"
     variation       1666
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1227848615"
     variation       1670
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1440613961"
     variation       1671
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:905019210"
     variation       1673
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1331422198"
     variation       1677
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:747725878"
     variation       1680
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:139655744"
     variation       1682
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:773822206"
     variation       1691
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1391745803"
     variation       1695
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:747306614"
     variation       1696
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:771396861"
     variation       1697
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:776976997"
     variation       1698
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:943607533"
     variation       1699
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:759772113"
     variation       1700
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:765556704"
     variation       1703
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:377138456"
     variation       1707
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1405687927"
     variation       1710
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1405087894"
     variation       1712
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:763114778"
     variation       1713
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:77657275"
     variation       1717
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:750412382"
     variation       1722
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1423107266"
     variation       1734
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:755855849"
     variation       1735
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:200950997"
     variation       1736
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:753635947"
     variation       1738
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:146444857"
     variation       1746
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1375566982"
     variation       1747
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1224439722"
     variation       1753
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:767169175"
     variation       1754..1755
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="gg"
                     /replace="ggtggg"
                     /db_xref="dbSNP:746527471"
     variation       1756..1757
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace=""
                     /replace="ctggg"
                     /db_xref="dbSNP:770390528"
     variation       1756
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1565243782"
     variation       1758
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:767997069"
     variation       1760
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1428898394"
     variation       1764
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1591812099"
     variation       1767
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:139482219"
     variation       1768
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1176496381"
     variation       1772
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1243488718"
     variation       1773
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:757969790"
     variation       1776..1780
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="gagag"
                     /replace="gagagag"
                     /db_xref="dbSNP:1452451864"
     variation       1778
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:778142032"
     variation       1782
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1203934329"
     variation       1783
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1230850944"
     variation       1785
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1481309988"
     variation       1786
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:75334581"
     variation       1788
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:771575517"
     variation       1792
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:777064999"
     variation       1793
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1222485044"
     variation       1794
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:746262560"
     variation       1798
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:770091461"
     variation       1799
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:775830036"
     variation       1806
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1310638638"
     variation       1811
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1168555745"
     variation       1815
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1356539356"
     variation       1816
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:762909149"
     variation       1821..1824
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="ggg"
                     /replace="gggg"
                     /db_xref="dbSNP:1232852759"
     variation       1821
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:892222231"
     variation       1824
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:149664604"
     variation       1825..1829
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace=""
                     /replace="accct"
                     /db_xref="dbSNP:1565244337"
     variation       1826
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:145676536"
     variation       1827
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1380677810"
     variation       1828
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1450281687"
     variation       1835
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:11200386"
     variation       1836
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:753581178"
     variation       1837
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1591812724"
     variation       1844
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:369132344"
     variation       1850
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1315940344"
     variation       1852
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:561985082"
     variation       1854
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:752463508"
     variation       1855
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:979196237"
     variation       1857
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1411146175"
     variation       1861
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1236316324"
     variation       1862
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:757836508"
     variation       1865
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1172950099"
     variation       1869
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:200528151"
     variation       1879
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:148904467"
     variation       1880
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:114762109"
     variation       1883
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:781769275"
     variation       1892
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:746211474"
     variation       1895
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:147619126"
     variation       1897
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="t"
                     /replace="tt"
                     /db_xref="dbSNP:1241814497"
     variation       1898
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1421904841"
     variation       1900
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1033556936"
     variation       1904
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1410675699"
     variation       1906
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1303839850"
     variation       1908
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1175638960"
     variation       1909
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:564223053"
     variation       1913
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1591813245"
     variation       1914
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1403935615"
     variation       1915
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:780133425"
     variation       1917
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:368410259"
     variation       1919
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1227270289"
     variation       1920
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:768766027"
     variation       1932
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1429753324"
     variation       1934
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:192159808"
     variation       1940
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1210835202"
     variation       1942
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:566315747"
     variation       1943
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:774452059"
     variation       1947
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:761904658"
     variation       1948
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:770836132"
     variation       1953
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1320750102"
     variation       1956
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:546635210"
     variation       1957
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:559696036"
     variation       1958
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1446995731"
     variation       1959..1988
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="gcacca"
                     /replace="gcaccaccccctcctcttcccaaggcacca"
                     /db_xref="dbSNP:1020613370"
     variation       1960
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:202141378"
     variation       1962..1963
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="cc"
                     /replace="ccc"
                     /db_xref="dbSNP:776272139"
     variation       1962
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:765078280"
     variation       1965..1969
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="cccc"
                     /replace="ccccc"
                     /db_xref="dbSNP:759133015"
     variation       1965
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1190786875"
     variation       1966
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:528658002"
     variation       1967
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1427508227"
     variation       1968
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1565245537"
     variation       1969
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:752444601"
     variation       1978
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:763681670"
     variation       1979
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:751028297"
     variation       1983
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1399973022"
     variation       1984
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:905028710"
     variation       1990
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:756875792"
     variation       1992
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1346694624"
     variation       1996
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1360885642"
     variation       1999
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1178325419"
     variation       2008
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:781755154"
     variation       2009
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1565245806"
     variation       2011
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:142141564"
     variation       2012
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:780400707"
     variation       2015
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1224830351"
     variation       2019
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1426922926"
     variation       2020..2021
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace=""
                     /replace="cg"
                     /db_xref="dbSNP:764501097"
     variation       2020
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:548635055"
     variation       2021
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:138675193"
     variation       2026
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:779053874"
     variation       2032
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201967564"
     variation       2033
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:373604882"
     variation       2034
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:772211415"
     variation       2037
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:759414892"
     variation       2038
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:375286554"
     variation       2039
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:868130401"
     variation       2045
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1200409000"
     variation       2046
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1411401726"
     variation       2048
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1468646591"
     variation       2049
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:775312857"
     variation       2052
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1009483361"
     variation       2053
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:762673854"
     variation       2057
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:371437428"
     variation       2058
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1565246362"
     variation       2060
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:763776508"
     variation       2061
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:774186572"
     variation       2064
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1220057312"
     variation       2070
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1591814582"
     variation       2073
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:761403864"
     variation       2074
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1318217606"
     variation       2075
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:767192455"
     variation       2077
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1303359837"
     variation       2080
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:749966059"
     variation       2082
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:756650921"
     variation       2083
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:868623666"
     variation       2087
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:766819530"
     variation       2088
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1412781477"
     variation       2089
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:967703549"
     variation       2090
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1303372202"
     variation       2093
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:754208971"
     variation       2096
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:368976938"
     variation       2097
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:779196180"
     variation       2099
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:748429941"
     variation       2107
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1223564644"
     variation       2108
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:758636102"
     variation       2111
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1436181308"
     variation       2112
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:777760422"
     variation       2113
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:747119603"
     variation       2114
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:769718707"
     variation       2116
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:761911531"
     variation       2117
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1565246940"
     variation       2130
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:775335544"
     variation       2131
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:7083776"
     variation       2133
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:768402028"
     variation       2134
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:141860738"
     variation       2137
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:761497503"
     variation       2141
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1434869581"
     variation       2142
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:766415523"
     variation       2144
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:555097355"
     variation       2147
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:772802074"
     variation       2151
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:149295961"
     variation       2153
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:150192288"
     variation       2158
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1452622441"
     variation       2165
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:182927465"
     variation       2167
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:754373092"
     variation       2169
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:138676514"
     variation       2177
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace=""
                     /replace="c"
                     /db_xref="dbSNP:1250989108"
     variation       2180
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:758516019"
     variation       2183
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:528483370"
     variation       2184
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:765465926"
     variation       2187
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:764011384"
     variation       2188
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:758575064"
     variation       2190
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:777989681"
     variation       2193
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:188032605"
     variation       2194
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:757318734"
     variation       2198
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1323309835"
     variation       2201
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1372152237"
     variation       2212
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1591815642"
     variation       2214
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1460212228"
     variation       2220
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:142251964"
     variation       2222
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1371156233"
     variation       2223
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:749239930"
     variation       2224
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:768651010"
     variation       2227
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:747979426"
     variation       2228
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:771828660"
     variation       2230
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:144525982"
     variation       2235
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1026573145"
     variation       2236
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1456664972"
     variation       2240
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:950570245"
     variation       2243
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1295214997"
     variation       2247
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:760229129"
     variation       2249
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1484746783"
     variation       2250
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1165993129"
     variation       2251
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:770408995"
     variation       2253
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1381715116"
     variation       2254..2266
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="ccagctcacactc"
                     /db_xref="dbSNP:774694320"
     variation       2258
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:776222468"
     variation       2262
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:759897081"
     variation       2265
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1261194202"
     variation       2267
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1591816082"
     variation       2268
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1462547161"
     variation       2270
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:535624704"
     variation       2271
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:896311539"
     variation       2274
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1489282823"
     variation       2278
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:113893072"
     variation       2279
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:964735729"
     variation       2280
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1426494594"
     variation       2284
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:763354809"
     variation       2287
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:764266181"
     variation       2288
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:751794067"
     variation       2290
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:757345853"
     variation       2291
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1591816362"
     variation       2292
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1311374362"
     variation       2295
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1408943663"
     variation       2296
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1467059301"
     variation       2300
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1288779126"
     variation       2302
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:60531929"
     variation       2303
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1384238466"
     variation       2304
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:750519794"
     variation       2306
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:372711396"
     variation       2307
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:754824553"
     variation       2308
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1393224247"
     variation       2312
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:779042725"
     variation       2317
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:747923514"
     variation       2321
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace=""
                     /replace="g"
                     /db_xref="dbSNP:1324359806"
     variation       2322
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1359122985"
     variation       2323
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1233942408"
     variation       2324
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:772061605"
     variation       2330
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:777557684"
     variation       2331
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1161001710"
     variation       2337
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:750786303"
     variation       2344
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1565248544"
     variation       2348
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:12246656"
     variation       2349
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1196194179"
     variation       2350
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1267690614"
     variation       2352
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1185645252"
     variation       2353
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:770626137"
     variation       2358
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1490064597"
     variation       2360
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:756674929"
     variation       2362
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:759104786"
     variation       2367
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:770259437"
     variation       2374
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1166423895"
     variation       2375
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:776015159"
     variation       2376
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:867958572"
     variation       2379
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:377480879"
     variation       2381
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1026545025"
     variation       2382
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1299114677"
     variation       2383
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:764499001"
     variation       2384
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:751965125"
     variation       2385
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201122938"
     variation       2386
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:750449339"
     variation       2388
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:756303366"
     variation       2390
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1306226094"
     variation       2391
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:778991503"
     variation       2392
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:148637680"
     variation       2396
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:780554760"
     variation       2397
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1286552880"
     variation       2398
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1300479885"
     variation       2399
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1420821296"
     variation       2400
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:199569835"
     variation       2402
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:539975814"
     variation       2403
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1270547451"
     variation       2406
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1170290648"
     variation       2411
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:746855730"
     variation       2419
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1467133093"
     variation       2420
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:756807063"
     variation       2421
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:142091094"
     variation       2430
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:745336794"
     variation       2432
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:371118062"
     variation       2433
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:769357558"
     variation       2437
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:775962093"
     variation       2438
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:749736471"
     variation       2439
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1165738314"
     variation       2443
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1254004453"
     variation       2444
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:769155262"
     variation       2450
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:774538172"
     variation       2451
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:762287107"
     variation       2456
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1296455453"
     variation       2458
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:767604128"
     variation       2460
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1448976430"
     variation       2461
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:773552274"
     variation       2467
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:760826192"
     variation       2469
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1401058971"
     variation       2470
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:766512610"
     variation       2471
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:753974305"
     variation       2475
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:758375668"
     variation       2476
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1321880106"
     variation       2478
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:764117878"
     variation       2479
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1249174665"
     variation       2483
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:751286519"
     variation       2484
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:528706688"
     variation       2486
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:151146332"
     variation       2487
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:745575153"
     variation       2493
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1185749198"
     variation       2497
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:755775293"
     variation       2499
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:373061354"
     variation       2501
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:748828410"
     variation       2504
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:917756850"
     variation       2506
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1026226062"
     variation       2507..2509
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="tt"
                     /replace="ttt"
                     /db_xref="dbSNP:762431847"
     variation       2509
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:769102037"
     variation       2510
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:139001743"
     variation       2512
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:201768336"
     variation       2515
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1171042722"
     variation       2518
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:772547313"
     variation       2519
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:773464003"
     variation       2523
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:370133969"
     variation       2528
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:41288002"
     variation       2529
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1292960472"
     variation       2533
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201927666"
     variation       2536
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1319428254"
     variation       2540
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1016075340"
     variation       2543
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:868288892"
     variation       2545
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:537115035"
     variation       2553
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1256931312"
     variation       2557
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:759735357"
     variation       2558
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:903795349"
     variation       2562
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1260237649"
     variation       2571..2573
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="aaa"
                     /replace="aaaa"
                     /db_xref="dbSNP:35940982"
     variation       2571
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:996224642"
     variation       2575
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201625808"
     variation       2577
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:561185577"
     variation       2583
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:756986623"
     variation       2584
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1475275986"
     variation       2588
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1356113781"
     variation       2593
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:767283030"
     variation       2594
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:889443017"
     variation       2595
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1421860489"
     variation       2604
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:570530902"
     variation       2608
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1341641620"
     variation       2609
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:755723859"
     variation       2612
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:779701973"
     variation       2617
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:533321618"
     variation       2620
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:754584500"
     variation       2621
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1327584464"
     variation       2622
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:370792706"
     variation       2624
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1359567691"
     variation       2627
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:546814637"
     variation       2628
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:147635960"
     variation       2632
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1401954590"
     variation       2633
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1341925893"
     variation       2635
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:772464828"
     variation       2641
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201466757"
     variation       2642
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:747403207"
     variation       2647
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:374576101"
     variation       2649
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:368073870"
     variation       2652
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:192876235"
     variation       2655
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:769972131"
     variation       2657
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:775443867"
     variation       2658
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:535338058"
     variation       2659
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:767385508"
     variation       2660
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:144398174"
     variation       2661
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:760512466"
     variation       2664
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1026886132"
     variation       2665
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1174278529"
     variation       2666
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:569034512"
     variation       2667
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1309190983"
     variation       2668
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:569744421"
     variation       2669
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:145289539"
     variation       2677
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:778422472"
     variation       2678
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:752182627"
     variation       2680
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:558056061"
     variation       2681
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:747341872"
     variation       2683
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1437935983"
     variation       2686
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:751950014"
     variation       2687
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1350507702"
     variation       2689
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:149165465"
     variation       2691
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1229166880"
     variation       2693..2762
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="tcatgctggggtgccacatcccccccagggggagaacttggcagcaga
                     cctggggctcacggcactcatc"
                     /replace="tcatgctggggtgccacatcccccccagggggagaacttggcagcaga
                     cctggggctcacggcactcatcatgctggggtgccacatcccccccagggggagaact
                     tggcagcagacctggggctcacggcactcatc"
                     /db_xref="dbSNP:1565251348"
     variation       2696
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:781548516"
     variation       2700
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:577728559"
     variation       2702
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:769911320"
     variation       2710
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:562599269"
     variation       2712..2718
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="cccccc"
                     /replace="ccccccc"
                     /replace="cccccccc"
                     /db_xref="dbSNP:750901207"
     variation       2712
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:762964320"
     variation       2713
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1277717545"
     variation       2714
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:867214057"
     variation       2715
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1199597673"
     variation       2716
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:773200885"
     variation       2717
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:370393890"
     variation       2718
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1048137249"
     variation       2719
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:145103148"
     variation       2720..2724
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="ggggg"
                     /replace="gggggg"
                     /db_xref="dbSNP:756151149"
     variation       2720
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:11597437"
     variation       2721
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:759190818"
     variation       2722
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1471985798"
     variation       2723
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:370877791"
     variation       2726
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:537034175"
     variation       2729
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1406609251"
     variation       2730
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:977973379"
     variation       2731
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:553632378"
     variation       2733
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:757503632"
     variation       2735
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:373805946"
     variation       2744..2747
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="ggg"
                     /replace="gggg"
                     /db_xref="dbSNP:1312059846"
     variation       2744
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:148302255"
     variation       2745
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:200640597"
     variation       2746
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1218202624"
     variation       2747
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1172333971"
     variation       2750
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:757850175"
     variation       2752
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:781633294"
     variation       2753
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:746247635"
     variation       2754
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:368496781"
     variation       2755
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:372856593"
     variation       2759
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:74901704"
     variation       2762
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:768782999"
     variation       2764
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201169518"
     variation       2767
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:145909090"
     variation       2768
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1366494014"
     variation       2769
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:954899233"
     variation       2776
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:770888861"
     variation       2777
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1395195880"
     variation       2782
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1565252297"
     variation       2783
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1407673514"
     variation       2787
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1361153971"
     variation       2791
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1159916934"
     variation       2793
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:138475310"
     variation       2794
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1401590237"
     variation       2797
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1423270574"
     variation       2799..2802
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="ggg"
                     /replace="gggg"
                     /db_xref="dbSNP:1174567037"
     variation       2799
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1452375961"
     variation       2800
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:147171017"
     variation       2801
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:764915560"
     variation       2804
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1245863074"
     variation       2811
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:775075745"
     variation       2815
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1489555792"
     variation       2816
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1264542655"
     variation       2817
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1337562560"
     variation       2820
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:762507712"
     variation       2823
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1259927483"
     variation       2824
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:968963111"
     variation       2825
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:763636597"
     variation       2828
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:746017280"
     variation       2829
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:150668512"
     variation       2830
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:768159687"
     variation       2832
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:750776742"
     variation       2833
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:958859981"
     variation       2834
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1274025678"
     variation       2835
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1372095023"
     variation       2838
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1476563960"
     variation       2840
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1345458637"
     variation       2843
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1172111754"
     variation       2847
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1591821131"
     variation       2856
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:756474425"
     variation       2859
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:10887063"
     variation       2861
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1335291450"
     variation       2863
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:887908913"
     variation       2865
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1404849634"
     variation       2866
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1396930945"
     variation       2870
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:749414532"
     variation       2876
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:778926377"
     variation       2880
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:564421543"
     variation       2884
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:770835948"
     variation       2886
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:776477606"
     variation       2887
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:745676113"
     variation       2888
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:377277808"
     variation       2890
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:775365809"
     variation       2899
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:762625092"
     variation       2900
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:368173512"
     variation       2901
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:773947901"
     variation       2904
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:761456928"
     variation       2905
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:768037393"
     variation       2906
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:750959270"
     variation       2908
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:761259077"
     variation       2910
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:766587352"
     variation       2911
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1379825254"
     variation       2914
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:140280635"
     variation       2916
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1244079867"
     variation       2917
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1210280761"
     variation       2918
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:142075625"
     variation       2919
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:779158034"
     variation       2922
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:752746017"
     variation       2926
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:758543512"
     variation       2927
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:781180184"
     variation       2929..2932
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="aaa"
                     /replace="aaaa"
                     /db_xref="dbSNP:766506682"
     variation       2933
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:149275566"
     variation       2936
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:371996281"
     variation       2939
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1047409790"
     variation       2941
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:779670767"
     variation       2944
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:529398984"
     variation       2951..2952
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="aa"
                     /replace="aaa"
                     /db_xref="dbSNP:747873325"
     variation       2951
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:376114582"
     variation       2954
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:774186447"
     variation       2956
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1381326737"
     variation       2969
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1286029248"
     variation       2970
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1490048887"
     variation       2971
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:761403994"
     variation       2978..2979
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace=""
                     /replace="tttg"
                     /db_xref="dbSNP:754168852"
     variation       2980..2981
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace=""
                     /replace="ca"
                     /db_xref="dbSNP:755243171"
     variation       2986
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1270100081"
     variation       2990
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:771425196"
     variation       2991
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:772782385"
     variation       2994
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1197805195"
     variation       2996
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:144481289"
     variation       2999
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:151325176"
     variation       3001
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1355443115"
     variation       3003
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1159498466"
     variation       3010
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:569094533"
     variation       3011
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1456461298"
     variation       3021
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1565254036"
     variation       3022
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1037615068"
     variation       3026
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:41288004"
     variation       3028
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1183592859"
     variation       3029
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1261968519"
     variation       3033
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:996005967"
     variation       3035
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:765438006"
     variation       3037
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:369401230"
     variation       3040
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:759349202"
     variation       3042
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1241981531"
     variation       3046
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1565254265"
     variation       3047
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:371747734"
     variation       3048
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1358197808"
     variation       3053
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:375029779"
     variation       3057
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:751695214"
     variation       3063
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1323367095"
     variation       3064
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1488505476"
     variation       3066
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:369006789"
     variation       3071
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:780090188"
     variation       3077
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1441945248"
     variation       3078
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1179579358"
     variation       3087
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:768639717"
     variation       3091
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1422347239"
     variation       3094
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:558111165"
     variation       3098
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1565254553"
     variation       3104
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1376290288"
     variation       3109
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1307223842"
     variation       3113
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1350579736"
     variation       3115
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1449245390"
     variation       3116
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1461510287"
     variation       3125
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:747735733"
     variation       3131
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:571515128"
     variation       3132
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:772546309"
     variation       3134
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1309792473"
     variation       3135
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:771308641"
     variation       3140
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:777186376"
     variation       3142
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1591823150"
     variation       3148
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1048579150"
     variation       3150
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1377924349"
     variation       3152
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:759877044"
     variation       3155
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1020247194"
     variation       3169
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:533590866"
     variation       3170
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:765524349"
     variation       3171
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:117734649"
     variation       3181
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:573509371"
     variation       3182
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:751566772"
     variation       3183
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:751571229"
     variation       3187
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1489355712"
     variation       3188
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1265915063"
     variation       3190
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:140606887"
     variation       3194
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1183848172"
     variation       3196
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1351481349"
     variation       3200
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1025016213"
     variation       3203
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1283952053"
     variation       3206
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1428005203"
     variation       3207
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1168535545"
     variation       3209
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:766415831"
     variation       3213
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:142194146"
     variation       3214
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1331920239"
     variation       3218
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:999620785"
     variation       3222
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:151198040"
     variation       3223
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:747977383"
     variation       3228
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1304184250"
     variation       3230
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:774454610"
     variation       3231
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:777520041"
     variation       3232
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1024869016"
     variation       3238
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1353645806"
     variation       3241..3314
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="ag"
                     /replace="agtcctcgagggtctcgcctccagcagcagatgtcttaaaagactttt
                     ctcttgcagggaacttcagcagaaag"
                     /db_xref="dbSNP:1565255515"
     variation       3241
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:970505269"
     variation       3242
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:746493115"
     variation       3247
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1275823352"
     variation       3248
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:373322084"
     variation       3250
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:112188313"
     variation       3251
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1278485981"
     variation       3252
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:376454944"
     variation       3255
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1212614772"
     variation       3256
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:770320810"
     variation       3257
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:149803621"
     variation       3259
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1191759613"
     variation       3261
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:973342664"
     variation       3262
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:567308602"
     variation       3264
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1265484100"
     variation       3269
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1231310372"
     variation       3271
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:764193740"
     variation       3274
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1171330269"
     variation       3277
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1591824234"
     variation       3282
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1424310114"
     variation       3283
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:774703041"
     variation       3284
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:931864180"
     variation       3285..3288
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="tt"
                     /replace="tttt"
                     /db_xref="dbSNP:1178047854"
     variation       3286
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:767648184"
     variation       3289
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1399066665"
     variation       3292
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1051623851"
     variation       3294
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1591824437"
     variation       3298
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1341866497"
     variation       3299
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:750562778"
     variation       3300
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1300617331"
     variation       3302
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1274789510"
     variation       3308
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:145748763"
     variation       3309
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:765313097"
     variation       3314
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1171043621"
     variation       3317
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1279848159"
     variation       3330
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:140641088"
     variation       3333
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:758278410"
     variation       3334
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1457489734"
     variation       3335..3338
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="ggg"
                     /replace="gggg"
                     /db_xref="dbSNP:1288371627"
     variation       3336
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1488668121"
     variation       3337
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:777275006"
     variation       3340
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1245051891"
     variation       3344
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1477034011"
     variation       3345
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:904553223"
     variation       3346
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:746610603"
     variation       3349
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:756903499"
     variation       3353
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:780242938"
     variation       3354
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1034283140"
     variation       3358
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:369386229"
     variation       3362
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1361997969"
     variation       3365
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1419777555"
     variation       3370
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:754393114"
     variation       3374
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1318279705"
     variation       3381
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:776019343"
     variation       3382
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:749612529"
     variation       3385
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:531738196"
     variation       3388
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:533671771"
     variation       3391
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:762054534"
     variation       3392
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:540533028"
     variation       3393
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1354777334"
     variation       3395
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:773402221"
     variation       3398
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1364273844"
     variation       3399
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1435639179"
     variation       3400
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="ccc"
                     /db_xref="dbSNP:1287880074"
     variation       3401
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1264008470"
     variation       3402
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:150064065"
     variation       3407
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1316483501"
     variation       3412
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:765258038"
     variation       3415
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1253492659"
     variation       3420
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:115790843"
     variation       3423
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:902532640"
     variation       3435
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:999906345"
     variation       3436
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:762808866"
     variation       3437
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1162257930"
     variation       3439
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1014664526"
     variation       3442
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:963069615"
     variation       3443
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1406554177"
     variation       3445..3448
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="ccc"
                     /replace="cccc"
                     /db_xref="dbSNP:778887227"
     variation       3446
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:751345990"
     variation       3447
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1445209818"
     variation       3449
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:893907659"
     variation       3452
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1378087580"
     variation       3458
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:756858369"
     variation       3460
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1282606971"
     variation       3461
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:780875270"
     variation       3463
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1228901996"
     variation       3471
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:61753073"
     variation       3475
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1457310713"
     variation       3476
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:375580409"
     variation       3481
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1239830123"
     variation       3484
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:780412768"
     variation       3485
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:762157882"
     variation       3486
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:562955567"
     variation       3488
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1473497381"
     variation       3490
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1165099565"
     variation       3492
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:769048028"
     variation       3495
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:779288189"
     variation       3499..3502
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="cc"
                     /replace="cccc"
                     /db_xref="dbSNP:747878043"
     variation       3499
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:748510179"
     variation       3500
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1366653303"
     variation       3504
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1267826947"
     variation       3505
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:143377886"
     variation       3512
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:773633306"
     variation       3513
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1342415729"
     variation       3517
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:760822277"
     variation       3526
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:201895792"
     variation       3528
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1565257724"
     variation       3530
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1591826266"
     variation       3532
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1277711233"
     variation       3539
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200089998"
     variation       3544
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1316120571"
     variation       3551
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1216763677"
     variation       3552
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:771074320"
     variation       3553
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1339848997"
     variation       3555
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1591826436"
     variation       3556
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:776575219"
     variation       3557
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1253813524"
     variation       3562
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:762904530"
     variation       3563
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:936063133"
     variation       3564
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1261892627"
     variation       3566
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:763964610"
     variation       3567
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:11200387"
     variation       3573
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1307948299"
     variation       3575
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:373281844"
     variation       3576
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:377162544"
     variation       3583
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:767703999"
     variation       3585
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1171256609"
     variation       3590
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:750135495"
     variation       3593
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:755777292"
     variation       3596
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:779550947"
     variation       3598..3601
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="ccc"
                     /replace="cccc"
                     /db_xref="dbSNP:1329222322"
     variation       3600
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:753310888"
     variation       3602
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1401867935"
     variation       3603
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1388431014"
     variation       3606
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1280024053"
     variation       3608..3611
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="ag"
                     /replace="agag"
                     /db_xref="dbSNP:758166315"
     variation       3609
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:755488831"
     variation       3615
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:951314455"
     variation       3620
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1254082078"
     variation       3624
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1591827046"
     variation       3626
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:779326266"
     variation       3627
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1385921928"
     variation       3630
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:748517134"
     variation       3635
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:547344614"
     variation       3638
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:747157686"
     variation       3639
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1178167076"
     variation       3642
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1438054962"
     variation       3645
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1046402183"
     variation       3646
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:887306452"
     variation       3652
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:771085934"
     variation       3653
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1261805424"
     variation       3655
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:776727702"
     variation       3656
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:745988155"
     variation       3657
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1197343035"
     variation       3658
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:768609936"
     variation       3659
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:41288006"
     variation       3660
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:761583861"
     variation       3661
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:199691186"
     variation       3662
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:772996349"
     variation       3664
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:937118499"
     variation       3665
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:746589548"
     variation       3668
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1289579921"
     variation       3670
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:58421538"
     variation       3671
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:753356833"
     variation       3678
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:7073433"
     variation       3679
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:765760444"
     variation       3680
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1591827641"
     variation       3686
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:953156616"
     variation       3688
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:753194129"
     variation       3689
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:143465172"
     variation       3692
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:778239169"
     variation       3693
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:374246191"
     variation       3699
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1046697933"
     variation       3701
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1210936430"
     variation       3704
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1260850232"
     variation       3705
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:757482922"
     variation       3706
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:781313118"
     variation       3717
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1254677297"
     variation       3718
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:745958023"
     variation       3723
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1270033021"
     variation       3724
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:769825628"
     variation       3729
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:967290744"
     variation       3731
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:775561709"
     variation       3732
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:147140774"
     variation       3734
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1378842106"
     variation       3735
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:977241449"
     variation       3737
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1441829059"
     variation       3739
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:925749060"
     variation       3741
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:748012977"
     variation       3744
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1477845250"
     variation       3745
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201283222"
     variation       3749
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:772967952"
     variation       3752
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:140254775"
     variation       3753
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:377358487"
     variation       3755
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1471657765"
     variation       3756
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:370359361"
     variation       3762
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:759236435"
     variation       3776
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:764582325"
     variation       3777
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200785553"
     variation       3780
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1307214920"
     variation       3782
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1591828416"
     variation       3784
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1218259462"
     variation       3785
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:758923315"
     variation       3786
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:764750855"
     variation       3787
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:751945438"
     variation       3789
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:566377148"
     variation       3791
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1591828534"
     variation       3794
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:776235670"
     variation       3796
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1198546831"
     variation       3808
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1236776851"
     variation       3811
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:141360696"
     variation       3812
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:145035433"
     variation       3814
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:756365382"
     variation       3816
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:780069470"
     variation       3819
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1167084166"
     variation       3820
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1418645005"
     variation       3828
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1461935934"
     variation       3829
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:138892486"
     variation       3838
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:368649119"
     variation       3839
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:958360797"
     variation       3845
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:777754404"
     variation       3846
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:898633554"
     variation       3850
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:372405430"
     variation       3852
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:867711974"
     variation       3857
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:770572757"
     variation       3861
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1294650888"
     variation       3862
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:776487415"
     variation       3864
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:759068587"
     variation       3872
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:560590906"
     variation       3874
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1320462719"
     variation       3875
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:775114861"
     variation       3876
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:762596354"
     variation       3879
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:764697787"
     variation       3881
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:574013647"
     variation       3884
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:543039628"
     variation       3885
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1477513653"
     variation       3886
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:750833650"
     variation       3891
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1421316772"
     variation       3894
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1476704358"
     variation       3898
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1411452249"
     variation       3900
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:563010428"
     variation       3903
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:780294751"
     variation       3904
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace=""
                     /replace="g"
                     /db_xref="dbSNP:1565260344"
     variation       3904
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:531851854"
     variation       3906
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:755107116"
     variation       3913
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:778975786"
     variation       3919
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:61756213"
     variation       3920
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1306914341"
     variation       3921
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1350703229"
     variation       3922
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:971124190"
     variation       3929
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:148462201"
     variation       3930
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1276863653"
     variation       3932
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1008991896"
     variation       3934
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:766394403"
     variation       3936
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:374367001"
     variation       3941
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1215651323"
     variation       3944
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:780796802"
     variation       3945
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:367931147"
     variation       3947
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:769543302"
     variation       3953
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:142607481"
     variation       3957
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:369885153"
     variation       3958
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1565260715"
     variation       3959
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1488011536"
     variation       3961
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1214458563"
     variation       3962
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1265420094"
     variation       3967
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1270778148"
     variation       3970
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1447410451"
     variation       3971
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:768227014"
     variation       3973
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:548512736"
     variation       3974
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace=""
                     /replace="t"
                     /db_xref="dbSNP:777605657"
     variation       3978
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:371617188"
     variation       3979
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1054002665"
     variation       3989
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1175145407"
     variation       3992
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:762187942"
     variation       3993
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1400001164"
     variation       3996
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1418714196"
     variation       3997
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1295868539"
     variation       4005
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1168855098"
     variation       4006
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:768092599"
     variation       4008
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1432154804"
     variation       4010
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:750732161"
     variation       4011
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:761093325"
     variation       4012
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:753999926"
     variation       4015
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:146828853"
     variation       4020
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:374980249"
     variation       4021
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:991612701"
     variation       4022
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1238220937"
     variation       4026
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1286480068"
     variation       4028
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1457079141"
     variation       4029
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:139627182"
     variation       4036
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:757115668"
     variation       4037
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:527457428"
     variation       4050
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:781226978"
     variation       4053
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1189702146"
     variation       4059
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1289090553"
     variation       4062
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1227774437"
     variation       4066
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:745649340"
     variation       4067
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:756035009"
     variation       4068
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1046167542"
     variation       4070
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:780010998"
     variation       4073
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:908501483"
     variation       4076
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1432408089"
     variation       4077..4084
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace=""
                     /replace="ccttacct"
                     /db_xref="dbSNP:1400731544"
     variation       4077
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1323492044"
     variation       4085
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1348578371"
     variation       4086
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1453643537"
     variation       4091
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:748886768"
     variation       4092
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:368826592"
     variation       4094
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:570203372"
     variation       4095
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1238286947"
     variation       4097
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:772452609"
     variation       4103
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:773826102"
     variation       4104
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:547702577"
     variation       4108
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1423336814"
     variation       4109
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:144252123"
     variation       4110
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1332665353"
     variation       4111
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:549308243"
     variation       4113
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:867691226"
     variation       4115
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1253433266"
     variation       4128
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:777008551"
     variation       4130
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:759701337"
     variation       4132
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1234196865"
     variation       4134
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:765543263"
     variation       4136
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:752685625"
     variation       4137
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:758573870"
     variation       4144
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1463512860"
     variation       4145
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:146552537"
     variation       4146
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1178675975"
     variation       4151
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1400059184"
     variation       4152
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1443838890"
     variation       4153
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:750322048"
     variation       4154
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:932790809"
     variation       4157
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:756129607"
     variation       4163
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1361579585"
     variation       4166
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:189703796"
     variation       4167
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:141191344"
     variation       4171
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:778669774"
     variation       4175
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1305156438"
     variation       4176
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1387737473"
     variation       4180
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1357409799"
     variation       4182
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:140508731"
     variation       4184
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:375356735"
     variation       4188
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:867158937"
     variation       4191
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1273678963"
     variation       4193
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1317079427"
     variation       4195
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:771550397"
     variation       4197
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1274850801"
     variation       4201
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1438103579"
     variation       4204
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1186372970"
     variation       4205
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:757619080"
     variation       4212
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1475874537"
     variation       4213
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:145858416"
     variation       4216
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1160800878"
     variation       4218
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:747473505"
     variation       4219
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:771446927"
     variation       4221
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201269542"
     variation       4225
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1424186719"
     variation       4227
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:759931970"
     variation       4233
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1414163684"
     variation       4238
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1332385929"
     variation       4244
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:368864486"
     variation       4245
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:371332642"
     variation       4246..4251
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="cccccc"
                     /replace="ccccccc"
                     /db_xref="dbSNP:1565262628"
     variation       4246
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:763099889"
     variation       4247
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1293834161"
     variation       4248
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:764172737"
     variation       4249
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1225136693"
     variation       4250
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:148992015"
     variation       4252
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:766468837"
     variation       4253
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1106992"
     variation       4254
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:200389636"
     variation       4261
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:754870626"
     variation       4262
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:778583843"
     variation       4264
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1211066156"
     variation       4267
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1347887090"
     variation       4270
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1032873351"
     variation       4277
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:752326690"
     variation       4278
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:866265498"
     variation       4283
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:138440519"
     variation       4288
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1195920400"
     variation       4289
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:777284379"
     variation       4293
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:77722854"
     variation       4297
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1565263029"
     variation       4298
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1172019785"
     variation       4303
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1290174956"
     variation       4309
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:578136211"
     variation       4311..4313
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="cc"
                     /replace="ccc"
                     /db_xref="dbSNP:746900532"
     variation       4311
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:746220751"
     variation       4314
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1591832748"
     variation       4317
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:145835442"
     variation       4318
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:763198415"
     variation       4322
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1320152000"
     variation       4324
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:990151098"
     variation       4328
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1591832864"
     variation       4332
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:143678523"
     variation       4334
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:774550802"
     variation       4335
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:762026579"
     variation       4336
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:766415869"
     variation       4339
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:754121824"
     variation       4345
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1259728976"
     variation       4346
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1207040450"
     variation       4348
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1284744082"
     variation       4349
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1484586855"
     variation       4350
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1565263457"
     variation       4351
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:753769021"
     variation       4352
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:199771319"
     variation       4356
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:759394267"
     variation       4362
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:574376849"
     variation       4363
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:908580173"
     variation       4369
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1397253374"
     variation       4380
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:755573981"
     variation       4389
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1218546185"
     variation       4390
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1158239667"
     variation       4392
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:752456833"
     variation       4393
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1348904647"
     variation       4395
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:940003180"
     variation       4397
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace=""
                     /replace="a"
                     /db_xref="dbSNP:1325271548"
     variation       4400
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1297011162"
     variation       4404
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:777439307"
     variation       4406
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2420984"
     variation       4412
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1160232595"
     variation       4415
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1385667245"
     variation       4416
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:141137444"
     variation       4418
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:756815559"
     variation       4422
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1372874231"
     variation       4426
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201403636"
     variation       4429
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:746310341"
     variation       4434
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1314623696"
     variation       4439
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:2420985"
     variation       4449
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1240476299"
     variation       4450
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1260795730"
     variation       4451
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1356331011"
     variation       4455
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:150806548"
     variation       4456
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:2420986"
     variation       4457
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1047104634"
     variation       4461
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:562873954"
     variation       4463
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:2901300"
     variation       4465
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:768892142"
     variation       4469
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:774783738"
     variation       4472
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:761973358"
     variation       4474
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1591833894"
     variation       4476
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:772210885"
     variation       4479
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:773457153"
     variation       4486
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:139193688"
     variation       4489
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:149524584"
     variation       4490
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:146003266"
     variation       4491
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1242652108"
     variation       4494
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:139901847"
     variation       4496
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:375410376"
     variation       4499
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:370022515"
     variation       4504
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:766977575"
     variation       4510
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:906834461"
     variation       4518
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:999028066"
     variation       4528
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:749926931"
     variation       4535
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:61753074"
     variation       4539
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:373598465"
     variation       4546
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:148089397"
     variation       4548
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:73370132"
     variation       4552
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1591834362"
     variation       4563
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1198489283"
     variation       4564..4566
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="aa"
                     /replace="aaa"
                     /db_xref="dbSNP:1383160609"
     variation       4565
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:142268660"
     variation       4567
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:748339041"
     variation       4568
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:753197990"
     variation       4569
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1565264695"
     variation       4571
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:561278421"
     variation       4572
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1591834582"
     variation       4573
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:747095730"
     variation       4575
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1591834626"
     variation       4577
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1168394869"
     variation       4578
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:529950167"
     variation       4584
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:775345822"
     variation       4586
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:762957952"
     variation       4597
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1012797762"
     variation       4601
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:763813576"
     variation       4602
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1565264873"
     variation       4605
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1446598277"
     variation       4607
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:549620504"
     variation       4608
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201709460"
     variation       4613
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1253159637"
     variation       4618
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:767210325"
     variation       4619
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:186111089"
     variation       4620
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:766896829"
     variation       4632
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:754242356"
     variation       4634
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:755571334"
     variation       4635
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1214475865"
     variation       4636
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:151338600"
     variation       4638
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:756835346"
     variation       4640
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1359637058"
     variation       4643
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1278614134"
     variation       4644
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:4752642"
     variation       4648
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:758659101"
     variation       4650
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1255573458"
     variation       4663
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:777920896"
     variation       4665
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:747095409"
     variation       4667
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:369857658"
     variation       4671
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1386136050"
     variation       4677
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:776779050"
     variation       4678
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:749187326"
     variation       4681..4698
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="ca"
                     /replace="cagtgggtaaagacctca"
                     /db_xref="dbSNP:770443389"
     variation       4681
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1430031081"
     variation       4682
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1166667485"
     variation       4684
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:768607283"
     variation       4693
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1591835383"
     variation       4695
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1394172349"
     variation       4697
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1301305433"
     variation       4699
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1432466986"
     variation       4700
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:774114513"
     variation       4703
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:147103470"
     variation       4704
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1430685678"
     variation       4706
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1199708536"
     variation       4707
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:147723400"
     variation       4710
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:772799623"
     variation       4716
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:867470186"
     variation       4718
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:745640843"
     variation       4721
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:765765099"
     variation       4724
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1346058715"
     variation       4725
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1347443826"
     variation       4737
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1236740359"
     variation       4751
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:554079517"
     variation       4754
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:948626847"
     variation       4755
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:760096865"
     variation       4760
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:765884417"
     variation       4761
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:752256733"
     variation       4765
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:758887730"
     variation       4767
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:567812975"
     variation       4769
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1224010366"
     variation       4770
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:372773858"
     variation       4773
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1283002232"
     variation       4776
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:757532639"
     variation       4777
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:142508761"
     variation       4779
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace=""
                     /replace="c"
                     /db_xref="dbSNP:1352479260"
     variation       4779
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:745999458"
     variation       4789..4796
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="agaag"
                     /replace="agaagaag"
                     /db_xref="dbSNP:1399558971"
     variation       4792
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1157568359"
     variation       4796
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1031734588"
     variation       4800
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:145895228"
     variation       4812
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:778889567"
     variation       4815
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:747926543"
     variation       4818
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1369192418"
     variation       4820
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1443418196"
     variation       4825
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:771707264"
     variation       4827
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:773065628"
     variation       4833
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:760195137"
     variation       4834
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:138712565"
     variation       4836
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:775971633"
     variation       4837
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:377557246"
     variation       4839
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:765823262"
     variation       4841
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:4751871"
     variation       4842
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201384640"
     variation       4844
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:143443054"
     variation       4845
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:751979400"
     variation       4846
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:7920896"
     variation       4852
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:781520600"
     variation       4853
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:750498409"
     variation       4859
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1164787944"
     variation       4860
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1236328663"
     variation       4863
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:756245611"
     variation       4864
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1463290783"
     variation       4871
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:780122291"
     variation       4875
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:748013331"
     variation       4877
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1054052519"
     variation       4880
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:777406394"
     variation       4882
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:746859836"
     variation       4884
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1374096374"
     variation       4887
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:770484899"
     variation       4888
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:776476408"
     variation       4890
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:201773248"
     variation       4891
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:141796592"
     variation       4892
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1290319071"
     variation       4895
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1436918556"
     variation       4898
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1201971567"
     variation       4899
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:763323058"
     variation       4900
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:764713772"
     variation       4903
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:907056248"
     variation       4905
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:774552350"
     variation       4906
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:762309480"
     variation       4907
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:146023378"
     variation       4908
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:750586655"
     variation       4913
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:756335605"
     variation       4916
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1408461199"
     variation       4924
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:753966616"
     variation       4928
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1355196565"
     variation       4930
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:556256653"
     variation       4931
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:908534813"
     variation       4934
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1291502888"
     variation       4939
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:777833001"
     variation       4942
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:746766875"
     variation       4944
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:139933944"
     variation       4946
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:781135664"
     variation       4948
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:745475032"
     variation       4949
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:769594745"
     variation       4951
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:775121013"
     variation       4955
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:374990835"
     variation       4956
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:769043605"
     variation       4959
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:995555590"
     variation       4960..4961
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="gg"
                     /db_xref="dbSNP:763510151"
     variation       4962
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1254746211"
     variation       4965
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:774980994"
     variation       4967
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1591837505"
     variation       4969
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1188803824"
     variation       4972
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1372890834"
     variation       4978..4989
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="cagcctggccag"
                     /replace="cagcctggccagcctggccag"
                     /db_xref="dbSNP:776107296"
     variation       4978
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:77105181"
     variation       4980..5001
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="gcc"
                     /replace="gcctggccaggcctggaaggcc"
                     /db_xref="dbSNP:1419438243"
     variation       4981
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:767804940"
     variation       4985
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1476124663"
     variation       4987
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:146103943"
     variation       4989
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:766627580"
     variation       4991
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1565267535"
     variation       4993
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:753857053"
     variation       4994
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:139774351"
     variation       5001
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1182569065"
     variation       5002
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1334686941"
     variation       5005
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:765242232"
     variation       5006
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:751443504"
     variation       5009
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1359762986"
     variation       5011
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:757170587"
     variation       5016
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:781082579"
     variation       5018
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:866903091"
     variation       5019
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:745709267"
     variation       5021
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:755799027"
     variation       5022
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1591838007"
     variation       5023
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1277611573"
     variation       5024
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1349352760"
     variation       5025
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:779920795"
     variation       5029
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1204067284"
     variation       5030
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:978249761"
     variation       5034
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:267602391"
     variation       5040
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1195847316"
     variation       5042
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1249015665"
     variation       5046
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1231212957"
     variation       5049
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1454032760"
     variation       5054
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:748735038"
     variation       5056
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:768158400"
     variation       5057
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1591838252"
     variation       5058
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1306298193"
     variation       5059
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:141300976"
     variation       5060
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1173096798"
     variation       5065
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:748652112"
     variation       5069
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1380445959"
     variation       5070
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:773532416"
     variation       5075
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:761091161"
     variation       5076
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1591838441"
     variation       5080
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1439735004"
     variation       5089
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1300731857"
     variation       5090
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:771124301"
     variation       5093
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1565268191"
     variation       5094
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1233421657"
     variation       5098
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:144683166"
     variation       5102
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:377713529"
     variation       5106
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:934420612"
     variation       5115
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:765318801"
     variation       5116
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1269200737"
     variation       5117
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1380859050"
     variation       5119
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:543590504"
     variation       5123
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:752740775"
     variation       5128
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200004584"
     variation       5129
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1052820093"
     variation       5131
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1054127152"
     variation       5133
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:767605167"
     variation       5135
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:543328111"
     variation       5136
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:77475605"
     variation       5140
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200979254"
     variation       5144
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1451583365"
     variation       5148
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:754620520"
     variation       5149
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1217362839"
     variation       5154
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:375588375"
     variation       5156
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:747649758"
     variation       5161
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1323638092"
     variation       5164
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:772560162"
     variation       5165
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:778307131"
     variation       5166
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:747524473"
     variation       5168
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1333441263"
     variation       5171
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1241838025"
     variation       5172
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1289465351"
     variation       5176
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:368266470"
     variation       5185
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:900024723"
     variation       5186
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:776890649"
     variation       5189
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1002749520"
     variation       5190
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:372471760"
     variation       5192
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1591839335"
     variation       5194
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:769956931"
     variation       5196
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1195403704"
     variation       5199
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1248537428"
     variation       5200
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:148498917"
     variation       5201
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:763193413"
     variation       5202
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:199669973"
     variation       5208
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1412699462"
     variation       5209
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:200211980"
     variation       5212
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:150804431"
     variation       5215
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1482522779"
     variation       5216
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:11599291"
     variation       5217
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:199665884"
     variation       5220
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:111241981"
     variation       5228
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:368179089"
     variation       5231
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:200645473"
     variation       5237
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:556922327"
     variation       5238
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:777266081"
     variation       5240
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:371295390"
     variation       5242
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1020010097"
     variation       5245
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:544094906"
     variation       5246
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:199785683"
     variation       5249
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1322645991"
     variation       5251
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:781596141"
     variation       5252
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:746260034"
     variation       5257
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:770052058"
     variation       5263
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:180675951"
     variation       5264
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:749535629"
     variation       5266
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1591840039"
     variation       5268
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1485324981"
     variation       5269
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1294100754"
     variation       5272
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:768793077"
     variation       5280
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201869943"
     variation       5283
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:760644346"
     variation       5285
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1169319366"
     variation       5286
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:866334081"
     variation       5287
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:766278349"
     variation       5288
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:916025093"
     variation       5293
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:202019397"
     variation       5297..5300
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="tg"
                     /replace="tgtg"
                     /db_xref="dbSNP:1413495846"
     variation       5302
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:989883649"
     variation       5310
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:147738883"
     variation       5311
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1380355451"
     variation       5314
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:75029377"
     variation       5316
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:765089820"
     variation       5320
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:866837240"
     variation       5328
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:981312019"
     variation       5331
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1293861577"
     variation       5333
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:368771136"
     variation       5335
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:758076925"
     variation       5336
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200150846"
     variation       5340
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:751117812"
     variation       5342
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:757749357"
     variation       5344
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:781617648"
     variation       5345
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1160958106"
     variation       5346
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:746232229"
     variation       5347
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1472813513"
     variation       5350..5351
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace=""
                     /replace="t"
                     /db_xref="dbSNP:1555016395"
     variation       5351..5352
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace=""
                     /replace="gtgaa"
                     /db_xref="dbSNP:745587557"
     variation       5351
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1565270027"
     variation       5351
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="ggtgaaagtg"
                     /db_xref="dbSNP:1428381008"
     variation       5353..5354
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace=""
                     /replace="tgac"
                     /db_xref="dbSNP:769406458"
     variation       5353
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:372221128"
     variation       5355
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:756376309"
     variation       5356
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1450988527"
     variation       5357
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:142571035"
     variation       5358
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:144811256"
     variation       5359
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1432249770"
     variation       5362
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1177597442"
     variation       5370
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:151181216"
     variation       5371
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1453644337"
     variation       5372
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:376774303"
     variation       5379
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:774554714"
     variation       5384
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1436123022"
     variation       5385
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:748281753"
     variation       5386
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:140209193"
     variation       5392
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:150315044"
     variation       5396
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:931120775"
     variation       5397
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:137931842"
     variation       5399
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1565270503"
     variation       5402
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:369479336"
     variation       5409
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1591841242"
     variation       5411
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:138082360"
     variation       5412
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:775285828"
     variation       5416..5423
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="cacca"
                     /replace="caccacca"
                     /db_xref="dbSNP:775159083"
     variation       5416
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:762572247"
     variation       5417
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:374266799"
     variation       5418
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:995530793"
     variation       5419
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:751066749"
     variation       5426
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1591841425"
     variation       5427
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1192474180"
     variation       5434
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:756776332"
     variation       5437
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:376809823"
     variation       5438
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:750828385"
     variation       5445
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:756680474"
     variation       5446
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:780520493"
     variation       5448
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:755222761"
     variation       5450
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1428031738"
     variation       5453
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1392632922"
     variation       5454
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:779332914"
     variation       5457
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1190731334"
     variation       5461
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1465562338"
     variation       5462
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:748413057"
     variation       5463
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:143666237"
     variation       5464
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1591841785"
     variation       5466
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:138754206"
     variation       5471
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:141796876"
     variation       5472
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:560783379"
     variation       5476
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:762801574"
     variation       5479
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:768285955"
     variation       5485
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace=""
                     /replace="c"
                     /db_xref="dbSNP:1227393008"
     variation       5486
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1272284472"
     variation       5492
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1591841970"
     variation       5500
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1295343423"
     variation       5506
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200641398"
     variation       5509
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1031208223"
     variation       5511
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:773937174"
     variation       5517..5521
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="aca"
                     /replace="acaca"
                     /db_xref="dbSNP:762114377"
     variation       5518
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:761531246"
     variation       5523
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:988756335"
     variation       5525
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1175995091"
     variation       5527..5532
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="gt"
                     /replace="gtgcgt"
                     /db_xref="dbSNP:1297167918"
     variation       5528
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:766898906"
     variation       5530
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:546030508"
     variation       5531
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace=""
                     /replace="g"
                     /db_xref="dbSNP:1565271574"
     variation       5531
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1164719489"
     variation       5534
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:116907408"
     variation       5535
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:753286281"
     variation       5539
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1324394874"
     variation       5543
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:754253084"
     variation       5544
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:755333219"
     variation       5546
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1309919536"
     variation       5550
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:528054480"
     variation       5561
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:752818434"
     variation       5566
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:933078892"
     variation       5567
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:758665794"
     variation       5568
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:777691521"
     variation       5570
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:747152605"
     variation       5573
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:769712352"
     variation       5574
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:749238677"
     variation       5577
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:774233662"
     variation       5578
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:779970534"
     variation       5580
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1253321445"
     variation       5584
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1444456360"
     variation       5585
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:200419452"
     variation       5586
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1187809613"
     variation       5587
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:771810058"
     variation       5588
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:772568688"
     variation       5602
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:760302647"
     variation       5605
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:746787282"
     variation       5606
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:969849286"
     variation       5613
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:760147773"
     variation       5614
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1591842939"
     variation       5615
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:980247617"
     variation       5617
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1276066462"
     variation       5618
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:928345161"
     variation       5619
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1371194782"
     variation       5620
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:758921659"
     variation       5623
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:765645451"
     variation       5624
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1312134244"
     variation       5626
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1338494040"
     variation       5628
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:148022903"
     variation       5630
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:995750903"
     variation       5634
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1022979827"
     variation       5636
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:758517700"
     variation       5638
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:764442622"
     variation       5639
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:548012482"
     variation       5641
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1002974128"
     variation       5643
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:757271399"
     variation       5645..5646
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="gg"
                     /db_xref="dbSNP:1210815864"
     variation       5648
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:918515169"
     variation       5652
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:956135133"
     variation       5653
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1444621227"
     variation       5655
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1188741221"
     variation       5656
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1365079685"
     variation       5658
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1241859943"
     variation       5660
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:561741785"
     variation       5663
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:749183444"
     variation       5664
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1390878349"
     variation       5665
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1434105447"
     variation       5674
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:754931537"
     variation       5677
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:778553198"
     variation       5682
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:748018931"
     variation       5684
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:771621338"
     variation       5685..5688
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="ccc"
                     /replace="cccc"
                     /db_xref="dbSNP:1417788599"
     variation       5685
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:772979275"
     variation       5694
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1165939944"
     variation       5699
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1432477123"
     variation       5700
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:746661006"
     variation       5710
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1365302633"
     variation       5711
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:10788237"
     variation       5714
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:550387151"
     variation       5715
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:760094555"
     variation       5717
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1289024778"
     variation       5718
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:369320771"
     variation       5719
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:763431049"
     variation       5720
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:764378043"
     variation       5723
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:751738477"
     variation       5726
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:570225185"
     variation       5727
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:371867918"
     variation       5728
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1453984019"
     variation       5733
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:767537356"
     variation       5734
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:865868863"
     variation       5735
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:754883354"
     variation       5736
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1404307778"
     variation       5741
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:974597241"
     variation       5745
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:778978597"
     variation       5747
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:747884557"
     variation       5749
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1455386109"
     variation       5750
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:758141860"
     variation       5751
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:777458270"
     variation       5753
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:746607621"
     variation       5755
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1391736896"
     variation       5758
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1158306556"
     variation       5759
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1591844481"
     variation       5761
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:770753371"
     variation       5768
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1452127900"
     variation       5769
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1298596702"
     variation       5770
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1332267749"
     variation       5774
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:773442499"
     variation       5775
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:199828025"
     variation       5777
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1183510976"
     variation       5781
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1480430073"
     variation       5783
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:372170043"
     variation       5784
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:776005771"
     variation       5788
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:763376130"
     variation       5789..5790
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace=""
                     /replace="tttttt"
                     /db_xref="dbSNP:1468240223"
     variation       5789
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1565273580"
     variation       5792..5793
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace=""
                     /replace="gc"
                     /db_xref="dbSNP:1208252788"
     variation       5792
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1269586490"
     variation       5794
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1452193932"
     variation       5796..5799
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace=""
                     /replace="caac"
                     /db_xref="dbSNP:1199498594"
     variation       5802
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:751080448"
     variation       5803
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1471555540"
     variation       5804
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:764481500"
     variation       5806
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1268591751"
     variation       5807..5810
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace=""
                     /replace="tcca"
                     /db_xref="dbSNP:1412383344"
     variation       5808
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:147160195"
     variation       5810
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1338194433"
     variation       5812..5813
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace=""
                     /replace="cc"
                     /db_xref="dbSNP:1291367775"
     variation       5813..5814
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace=""
                     /replace="cc"
                     /db_xref="dbSNP:1392263758"
     variation       5817
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:762000937"
     variation       5819
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1306861270"
     variation       5820
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1349239193"
     variation       5823
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:376248779"
     variation       5826..5831
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="ga"
                     /replace="gacaga"
                     /db_xref="dbSNP:1331861033"
     variation       5829
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace=""
                     /replace="a"
                     /db_xref="dbSNP:1317871693"
     variation       5829
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:760804922"
     exon            5831..5944
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /inference="alignment:Splign:2.1.0"
     variation       5838
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1412254309"
     variation       5839
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1309108496"
     variation       5843
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1378910055"
     variation       5846
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1394724212"
     variation       5847
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:984093274"
     variation       5849
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1315259638"
     variation       5851
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1429659366"
     variation       5855
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:376075858"
     variation       5856
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:760835902"
     variation       5857
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1161105358"
     variation       5860..5864
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="tacct"
                     /replace="tacctacct"
                     /db_xref="dbSNP:1457646127"
     variation       5863
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1471761519"
     variation       5866
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:766430639"
     variation       5867
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:563753676"
     variation       5868
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:762912856"
     variation       5871
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:764003429"
     variation       5879
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:751385080"
     variation       5880
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1179951126"
     variation       5881
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1191981810"
     variation       5883
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:976991720"
     variation       5884
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:954821404"
     variation       5886
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1187493690"
     variation       5889
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1387797360"
     variation       5890
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1008778698"
     variation       5892
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:370448226"
     variation       5893
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:781137814"
     variation       5895
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:139266734"
     variation       5896
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1464955271"
     variation       5897
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:755745408"
     variation       5902
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:779595950"
     variation       5906
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:748790404"
     variation       5909
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1356961017"
     variation       5912
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:769204792"
     variation       5917
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:779457735"
     variation       5921
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1229299286"
     variation       5925
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:973574478"
     variation       5926
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1311575558"
     variation       5929
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:748671437"
     variation       5930
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:373310579"
     variation       5931
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1483424275"
     variation       5934
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:773585574"
     variation       5935
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:749273199"
     variation       5943
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:201272664"
     exon            5945..6070
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /inference="alignment:Splign:2.1.0"
     variation       5949
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1215713065"
     variation       5951
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:778199158"
     variation       5953
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1249483062"
     variation       5954
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1592393907"
     variation       5957
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:747563042"
     variation       5961
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:893970982"
     variation       5963
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:757494792"
     variation       5964..5969
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="atc"
                     /replace="atcatc"
                     /db_xref="dbSNP:1419489454"
     variation       5969
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1565392599"
     variation       5970
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1396135826"
     variation       5971
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:781643198"
     variation       5974
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1229634950"
     variation       5975
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:545751147"
     variation       5976
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:199955284"
     variation       5980..5984
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="ccccc"
                     /replace="cccccc"
                     /db_xref="dbSNP:1203641585"
     variation       5980
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:775681531"
     variation       5981
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:759031271"
     variation       5984
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:374068486"
     variation       5985
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:772123235"
     variation       5987
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1254753477"
     variation       5988
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:772966997"
     variation       5996
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1042906107"
     variation       5999
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:145341685"
     variation       6000
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:770595283"
     variation       6003
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:776535002"
     variation       6004
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:759153407"
     variation       6007
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:764934219"
     variation       6010
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1372384478"
     variation       6012
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:560859062"
     variation       6013
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:762389768"
     variation       6014
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:763662132"
     variation       6017
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1357162289"
     variation       6019..6020
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="cc"
                     /db_xref="dbSNP:761248045"
     variation       6021
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:751970211"
     variation       6024
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1364004763"
     variation       6025
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1416902470"
     variation       6026
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:757804259"
     variation       6027
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:750857540"
     variation       6028
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1014587081"
     variation       6030
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="gg"
                     /db_xref="dbSNP:766629490"
     variation       6032..6042
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace=""
                     /replace="tgttgttggcc"
                     /db_xref="dbSNP:755296347"
     variation       6032..6039
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="tgttg"
                     /replace="tgttgttg"
                     /db_xref="dbSNP:753935010"
     variation       6034
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201242530"
     variation       6036
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1276961485"
     variation       6042
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1444420674"
     variation       6043
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:147336554"
     variation       6044..6045
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace=""
                     /replace="aa"
                     /db_xref="dbSNP:765583276"
     variation       6045..6046
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace=""
                     /replace="aaagaaagaaagatctacaaaggtttctaaacacttacttgaggtt"
                     /db_xref="dbSNP:1565393487"
     variation       6045
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:367601425"
     variation       6046..6062
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace=""
                     /replace="tctctacggatctgata"
                     /db_xref="dbSNP:1565393533"
     variation       6046
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:749537807"
     variation       6047
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:769340180"
     variation       6049
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:779085099"
     variation       6052
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:141016456"
     variation       6053
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:114501786"
     variation       6054
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:759382200"
     variation       6055
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:769587453"
     variation       6056
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1481459939"
     variation       6057
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1399803331"
     variation       6063
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:775056069"
     variation       6064
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:762623543"
     variation       6067
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:144877654"
     variation       6070
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:762196038"
     exon            6071..6205
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /inference="alignment:Splign:2.1.0"
     variation       6071
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:749174067"
     variation       6073..6076
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="tc"
                     /replace="tctc"
                     /db_xref="dbSNP:1169179342"
     variation       6076
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:768181228"
     variation       6084
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1414490769"
     variation       6094
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:200169711"
     variation       6095
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:565889394"
     variation       6096
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1364062338"
     variation       6100
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1231310621"
     variation       6102
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:767055639"
     variation       6107
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:895950254"
     variation       6108
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:534481630"
     variation       6109
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:377123555"
     variation       6110
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:145822203"
     variation       6113
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:752923046"
     variation       6117
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:12765679"
     variation       6120
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1220747870"
     variation       6121
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1393560870"
     variation       6123..6125
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="ata"
                     /db_xref="dbSNP:777569322"
     variation       6123
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1340142931"
     variation       6126
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1442203613"
     variation       6127..6129
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="tt"
                     /replace="ttt"
                     /db_xref="dbSNP:746979348"
     variation       6130
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:369648685"
     variation       6131
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:751678488"
     variation       6133
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:142578469"
     variation       6134
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:780024892"
     variation       6135
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1273901341"
     variation       6141
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:753733864"
     variation       6142
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:754737818"
     variation       6145
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1280849029"
     variation       6148
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:778606346"
     variation       6154
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1422902389"
     variation       6155
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1184882845"
     variation       6156
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:770450758"
     variation       6157
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1592557165"
     variation       6158
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:556529935"
     variation       6162
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1444788385"
     variation       6166
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1344502759"
     variation       6167
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1167402538"
     variation       6168
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1369298895"
     variation       6169
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:191364618"
     variation       6171
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1426135207"
     variation       6172
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:770573957"
     variation       6173
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1350304247"
     variation       6176
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:964403375"
     variation       6180
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1394526091"
     variation       6182
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:150954247"
     variation       6183
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:759990714"
     variation       6187
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:140845862"
     variation       6188
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:775765147"
     variation       6190
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:373555551"
     variation       6191
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:182296008"
     variation       6195
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1251685959"
     variation       6200
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:988631023"
     variation       6204
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1197580486"
     exon            6206..6342
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /inference="alignment:Splign:2.1.0"
     variation       6206
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1267804748"
     variation       6212
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:756957694"
     variation       6224
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1303739623"
     variation       6233
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:767142432"
     variation       6239
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:750095297"
     variation       6247
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1447537978"
     variation       6248
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1198528351"
     variation       6251
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:755521071"
     variation       6256
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:201603538"
     variation       6261
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1555121169"
     variation       6265
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:140413175"
     variation       6266
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:201214429"
     variation       6272
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1362915299"
     variation       6272
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="t"
                     /replace="tt"
                     /db_xref="dbSNP:1555121236"
     variation       6273..6289
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="ccacccccaccaccccc"
                     /replace="ccacccccaccacccccaccaccccc"
                     /db_xref="dbSNP:34095801"
     variation       6273
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1451142111"
     variation       6274
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1455549169"
     variation       6275
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1593181463"
     variation       6276..6280
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="ccccc"
                     /replace="cccccccc"
                     /db_xref="dbSNP:1159831976"
     variation       6276
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1384973683"
     variation       6277
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1424586328"
     variation       6279
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1301905535"
     variation       6280
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:755517441"
     variation       6281..6284
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace=""
                     /replace="acca"
                     /db_xref="dbSNP:1318215449"
     variation       6281
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:779223549"
     variation       6283
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1565571513"
     variation       6284
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:748566906"
     variation       6285..6290
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="ccccc"
                     /replace="cccccc"
                     /db_xref="dbSNP:1565571647"
     variation       6285
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:773254764"
     variation       6286
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:770879290"
     variation       6287
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1241392502"
     variation       6288
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:776893320"
     variation       6289
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:58106543"
     variation       6290
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1220348519"
     variation       6291
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:765054573"
     variation       6292
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1490814775"
     variation       6293
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:368856332"
     variation       6295
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1593182285"
     variation       6301
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1313463255"
     variation       6302
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1432963606"
     variation       6303
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:961067010"
     variation       6305
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:765841579"
     variation       6308
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:138045107"
     variation       6309
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:140976774"
     variation       6313
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1382634186"
     variation       6316
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:149503672"
     variation       6317
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1183446641"
     variation       6318
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1364012217"
     variation       6323
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:758645827"
     variation       6324
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:778234573"
     variation       6331
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:532281287"
     variation       6332
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:144751396"
     variation       6340
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1177703431"
     exon            6343..7654
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /inference="alignment:Splign:2.1.0"
     variation       6343..6357
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace=""
                     /replace="gatgtggttctgaga"
                     /db_xref="dbSNP:1187559665"
     variation       6343
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:868704474"
     variation       6346
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1565627967"
     variation       6348
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:776454653"
     variation       6349
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1479692439"
     variation       6352
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:948411212"
     variation       6356
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1202010230"
     variation       6358
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:745501319"
     variation       6363
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:769496601"
     variation       6368
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:774860841"
     variation       6370
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1175221066"
     variation       6373
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:762460420"
     variation       6376
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1479278284"
     variation       6379
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1268820302"
     variation       6381
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:763525770"
     variation       6382
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:373068885"
     variation       6386
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:762441531"
     variation       6387
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1402926596"
     variation       6390
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1284928578"
     variation       6391
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:376162843"
     variation       6392..6396
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="gg"
                     /replace="ggtgg"
                     /db_xref="dbSNP:1031378520"
     variation       6392
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:756389507"
     variation       6396
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1329642994"
     variation       6399
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:766688126"
     variation       6402
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1262320291"
     variation       6405
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:866000543"
     variation       6411
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:148110955"
     variation       6412
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:370799288"
     variation       6414
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1216683665"
     variation       6415
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1219899214"
     variation       6416
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1291747880"
     variation       6417
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1361812227"
     variation       6418
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:564717762"
     variation       6419
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:143883746"
     variation       6425
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:780955004"
     variation       6426
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1437946703"
     variation       6427
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1166796802"
     variation       6428..6432
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="ct"
                     /replace="cttct"
                     /db_xref="dbSNP:773619764"
     variation       6431
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1389808854"
     variation       6433
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:745730679"
     variation       6437
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:769483248"
     variation       6438
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1008585258"
     variation       6440
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:775150815"
     variation       6443..6444
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace=""
                     /replace="aa"
                     /db_xref="dbSNP:761300973"
     variation       6443
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:748916908"
     variation       6444
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:773774461"
     variation       6445
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:762386374"
     variation       6446..6447
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace=""
                     /replace="tg"
                     /db_xref="dbSNP:771538634"
     variation       6446
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:772763191"
     variation       6447
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:761051733"
     variation       6450
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:766662877"
     variation       6452
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:201905665"
     variation       6455
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:759721170"
     variation       6457
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1441037916"
     variation       6467
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1296165600"
     variation       6470
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1375033420"
     variation       6474
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1240305957"
     variation       6485
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:765341262"
     variation       6486
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1176088242"
     variation       6488
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1313678251"
     variation       6489
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1427434133"
     variation       6491
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1357969883"
     variation       6492
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1022571261"
     variation       6496
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1291054240"
     variation       6498
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:964270789"
     variation       6499
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:967106481"
     variation       6500
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:752835692"
     variation       6503
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:773783823"
     variation       6507..6510
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="gtgg"
                     /replace="gtggtgg"
                     /db_xref="dbSNP:777232638"
     variation       6507
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1029661399"
     variation       6508
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1183086070"
     variation       6514
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1241309431"
     variation       6519
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1442703845"
     variation       6523
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1165326358"
     variation       6528
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:116183037"
     variation       6531
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:750376265"
     variation       6532
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:755889268"
     variation       6534
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:376786391"
     variation       6535
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:540765159"
     variation       6538
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:560482573"
     variation       6544
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:373908144"
     variation       6545
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:370168206"
     variation       6546
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:529296575"
     variation       6556
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:771710153"
     variation       6561
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:916176525"
     variation       6564
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1213227589"
     variation       6568
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1275492631"
     variation       6569
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1303099860"
     variation       6572
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:773794685"
     variation       6576
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:761282634"
     variation       6577
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:771284294"
     variation       6578
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1462754633"
     variation       6579
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:776913120"
     variation       6580
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1275479836"
     variation       6581
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:549215108"
     variation       6589
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1475016676"
     variation       6590
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:765447651"
     variation       6592
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1181469493"
     variation       6595
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1425362468"
     variation       6596
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:752923829"
     variation       6597
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:199696107"
     variation       6600
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1175338836"
     variation       6601
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1254138834"
     variation       6604
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:7083331"
     variation       6607
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1272564235"
     variation       6611
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1191111839"
     variation       6613
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:756044688"
     variation       6615
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:779876538"
     variation       6616
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1334222006"
     variation       6617
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:753632492"
     variation       6620
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:200529740"
     variation       6623
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1272291538"
     variation       6624
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:747813403"
     variation       6625
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:771655052"
     variation       6626
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1261569123"
     variation       6628
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:111994437"
     variation       6629
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:747532165"
     variation       6632
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1283604528"
     variation       6635
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:372635027"
     variation       6638
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1213489310"
     variation       6645
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:777051347"
     variation       6650
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1342604887"
     variation       6655
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:906864557"
     variation       6659
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:746155868"
     variation       6660
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1198381623"
     variation       6669
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1426827893"
     variation       6673
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1390452206"
     variation       6676
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:3750843"
     variation       6680
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1172685149"
     variation       6681
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:775643365"
     variation       6683
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1383528125"
     variation       6684
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:143340046"
     variation       6686
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:764129065"
     variation       6687
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:114995590"
     variation       6690
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:376178888"
     variation       6692
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:766292512"
     variation       6693
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:760159868"
     variation       6697
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:753817518"
     variation       6701
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1279050241"
     variation       6704
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:754669268"
     variation       6705
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:765143512"
     variation       6706
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1288126420"
     variation       6707
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:752353928"
     variation       6708
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:758161048"
     variation       6710
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:777412834"
     variation       6711
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:746572352"
     variation       6713
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1565631962"
     variation       6715
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:756797942"
     variation       6716
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:781496938"
     variation       6718
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:199969252"
     variation       6728
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1468212441"
     variation       6730
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:770104155"
     variation       6731
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:957496572"
     variation       6734
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1268321360"
     variation       6735
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1381505226"
     variation       6737
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1424544716"
     variation       6740
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1208559524"
     variation       6741
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1029876000"
     variation       6748
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:775874142"
     variation       6760
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:749489269"
     variation       6761
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:139376398"
     variation       6763
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:774482969"
     variation       6766
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:202246830"
     variation       6767
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:79619171"
     variation       6769
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:150034118"
     variation       6772
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:867989093"
     variation       6776..6781
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="aaaaa"
                     /replace="aaaaaa"
                     /db_xref="dbSNP:1447689928"
     variation       6777
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:868039262"
     variation       6781
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:866202883"
     variation       6785
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:759573053"
     variation       6786
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1289335828"
     variation       6790
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1358270530"
     variation       6793
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1210204744"
     variation       6800
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:765090078"
     variation       6801
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1435669586"
     variation       6803
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1300809535"
     variation       6810
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1593386961"
     variation       6811..6817
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="ccccccc"
                     /replace="cccccccc"
                     /db_xref="dbSNP:759725298"
     variation       6812
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1180009063"
     variation       6816
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:139868428"
     variation       6817
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:183608136"
     variation       6819
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:751241062"
     variation       6825
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:115286612"
     variation       6827
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:780787166"
     variation       6829
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:538567560"
     variation       6830
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:114199549"
     variation       6838
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:749720151"
     variation       6839
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1332128588"
     variation       6841
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:769011931"
     variation       6845
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:915739324"
     variation       6849
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1593387531"
     variation       6853
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1196937628"
     variation       6855
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:948515169"
     variation       6857
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:778943409"
     variation       6858
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1312917152"
     variation       6860
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:748421472"
     variation       6861
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1245301953"
     variation       6862
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:145907362"
     variation       6865
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1250514618"
     variation       6867
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:554116886"
     variation       6874
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:202181709"
     variation       6881
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:375248756"
     variation       6883
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:934338274"
     variation       6885
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1463797112"
     variation       6889
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:773378377"
     variation       6890
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:759521622"
     variation       6892
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:769922555"
     variation       6893
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:775575434"
     variation       6894
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1424854899"
     variation       6895
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:146669395"
     variation       6896
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1371630068"
     variation       6897
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1467391447"
     variation       6903
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1171725889"
     variation       6910
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:777280236"
     variation       6911
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:370832508"
     variation       6916
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:115985418"
     variation       6917
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1381295430"
     variation       6923
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:750005707"
     variation       6924
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1294603489"
     variation       6927
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:914335011"
     variation       6928
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:944637263"
     variation       6929
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:756607567"
     variation       6933
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:369583357"
     variation       6936
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1378317701"
     variation       6939
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:755283163"
     variation       6943
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:114927453"
     variation       6944
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:35913854"
     variation       6945
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:772383562"
     variation       6948
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:747020874"
     variation       6954
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:371355623"
     variation       6956
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:151005188"
     variation       6957
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:763017330"
     variation       6960
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:768305770"
     variation       6961
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2295873"
     variation       6962
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:761359884"
     variation       6964
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1359759378"
     variation       6965
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:767266341"
     variation       6966
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:760120159"
     variation       6967
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:765895151"
     variation       6973
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1331893143"
     variation       6978
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:754298643"
     variation       6979
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1298529946"
     variation       6981
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:755545115"
     variation       6982
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:779121471"
     variation       6984
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:775097315"
     variation       6987
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:753160407"
     variation       6989
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1312322640"
     variation       6991
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1015585332"
     variation       6992
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:758697172"
     variation       6995
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:150139481"
     variation       6996
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:138777606"
     variation       6999
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:556551802"
     variation       7000
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2295874"
     variation       7004
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:768698106"
     variation       7005
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1426135698"
     variation       7007
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:368777371"
     variation       7011
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:747907952"
     variation       7013..7018
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="cccccc"
                     /replace="ccccccc"
                     /db_xref="dbSNP:765296364"
     variation       7013
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:771776690"
     variation       7014
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1298586776"
     variation       7015
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1364667209"
     variation       7017
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1434010762"
     variation       7018
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:2295875"
     variation       7019
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:149346540"
     variation       7020
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1390363878"
     variation       7021
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1306390301"
     variation       7025
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:932746007"
     variation       7026
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:765839539"
     variation       7027
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:955968932"
     variation       7028
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1291676037"
     variation       7033
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:776164733"
     variation       7036
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1224202036"
     variation       7037
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:759943943"
     variation       7040
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:371850863"
     variation       7041
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:753159948"
     variation       7046
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:758745427"
     variation       7047
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1275295684"
     variation       7050
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1441479270"
     variation       7052
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:554653985"
     variation       7053
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1405097009"
     variation       7055
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1593391165"
     variation       7056
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:144863138"
     variation       7057
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:781409575"
     variation       7058
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:202168550"
     variation       7059
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:756151344"
     variation       7061
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1040284989"
     variation       7062
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:547042157"
     variation       7067
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1461134307"
     variation       7069
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:778850142"
     variation       7070
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:748058471"
     variation       7073
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:771859124"
     variation       7074
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:773027256"
     variation       7075
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1363135915"
     variation       7076
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:746637680"
     variation       7077
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:770625460"
     variation       7080
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="aa"
                     /db_xref="dbSNP:1169750358"
     variation       7081
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1290989544"
     variation       7084
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:776111533"
     variation       7085
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:759031402"
     variation       7088
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1260219289"
     variation       7089
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1458324936"
     variation       7090
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:375927409"
     variation       7091
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:776030064"
     variation       7092
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:772054587"
     variation       7097
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:567258547"
     variation       7099
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1054109938"
     variation       7100
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:752028950"
     variation       7102
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:892825068"
     variation       7105
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1004463763"
     variation       7107
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1593392323"
     variation       7108
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1168179643"
     variation       7114
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:575786348"
     variation       7115
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:35532970"
     variation       7118
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:780028150"
     variation       7119
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:369011900"
     variation       7121
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:148585687"
     variation       7122..7127
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="gggggg"
                     /replace="ggggggg"
                     /db_xref="dbSNP:752879677"
     variation       7122
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:114482287"
     variation       7124
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:907333113"
     variation       7126
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:745542749"
     variation       7127
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:769319405"
     variation       7138
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:774912294"
     variation       7140
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:763504346"
     variation       7141
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:769355165"
     variation       7142
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1203132721"
     variation       7143
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:775004619"
     variation       7144
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:762208855"
     variation       7145
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1198068596"
     variation       7147
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1212228565"
     variation       7149
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1003015440"
     variation       7151
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:114946191"
     variation       7152
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1477398525"
     variation       7153
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2295876"
     variation       7154
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:373331825"
     variation       7157
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:75938210"
     variation       7158
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:187285591"
     variation       7160
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:956189831"
     variation       7163
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1422377862"
     variation       7165
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201583201"
     variation       7167
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:758324126"
     variation       7169
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:143290941"
     variation       7180
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:751522644"
     variation       7184
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:11200483"
     variation       7186
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:373769936"
     variation       7188
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:745516639"
     variation       7194
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:769391107"
     variation       7196
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:779612306"
     variation       7199
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:748741805"
     variation       7200
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1211812468"
     variation       7202
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1388343217"
     variation       7208
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:139126450"
     variation       7210
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:774947544"
     variation       7216
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1487895676"
     variation       7217
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1282699180"
     variation       7221
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:762439872"
     variation       7222
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:543214534"
     variation       7224
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:985529652"
     variation       7228
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1264979872"
     variation       7229
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1430980605"
     variation       7234
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1488422146"
     variation       7236
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:921705233"
     variation       7237
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:543134454"
     variation       7239
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1478746956"
     variation       7251
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:773494596"
     variation       7258
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:777183522"
     variation       7260
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:944497773"
     variation       7262
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1448852295"
     variation       7264
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:766573375"
     variation       7280
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1361503258"
     variation       7281
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1404718695"
     variation       7288
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:975894274"
     variation       7291
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200197716"
     variation       7292
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:200903142"
     variation       7294
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:765335838"
     variation       7295
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:116727041"
     variation       7296
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:948396343"
     variation       7300
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1237798802"
     variation       7302
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:757238700"
     variation       7303
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:558512351"
     variation       7305
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:370847934"
     variation       7308
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:755943697"
     variation       7309
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:779516893"
     variation       7311
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1198989164"
     variation       7317
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:374042332"
     variation       7318
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1301866447"
     variation       7319
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1002609375"
     variation       7326
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:868694930"
     variation       7327
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1438395704"
     variation       7328
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:754496276"
     variation       7333
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:778605279"
     variation       7334
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:765911016"
     variation       7338
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:753269912"
     variation       7343
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:773617869"
     variation       7345
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:747267478"
     variation       7347
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1360376530"
     variation       7348
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:771337694"
     variation       7351
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1593395819"
     variation       7359
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:776679676"
     variation       7362
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:149875675"
     variation       7364
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:765282692"
     variation       7369
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:954043928"
     variation       7371
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1044360808"
     variation       7376
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:775608705"
     variation       7377
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1243822780"
     variation       7378
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:761734973"
     variation       7384
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:767291670"
     variation       7387
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:750389683"
     variation       7394
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1255268589"
     variation       7400
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1181478921"
     variation       7403
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1019634630"
     variation       7405
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:905990877"
     variation       7408
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:755818965"
     variation       7412
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1211698784"
     variation       7417
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1342007948"
     variation       7418
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:377341447"
     variation       7420
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:763469698"
     variation       7426
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1423707190"
     variation       7427
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:754726978"
     variation       7428
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:111795908"
     variation       7430
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:778549690"
     variation       7440
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1473323611"
     variation       7441
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:564839203"
     variation       7444
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1170321699"
     variation       7445
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:747723437"
     variation       7449
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:757927053"
     variation       7455
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:778080991"
     variation       7458
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:372505760"
     variation       7459
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:377103453"
     variation       7460
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1395314344"
     variation       7463
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:771171727"
     variation       7465
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1342098788"
     variation       7478
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:373771227"
     variation       7481
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:199568460"
     variation       7485
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:746080998"
     variation       7489
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:370327996"
     variation       7490
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1315632999"
     variation       7499
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:770069199"
     variation       7501
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:955858634"
     variation       7502
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:375899573"
     variation       7503
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:183996280"
     variation       7506
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1258869046"
     variation       7508
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1443397153"
     variation       7512
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:768804346"
     variation       7518
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1421786447"
     variation       7522
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1162433155"
     variation       7523
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:375253951"
     variation       7525
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:763304795"
     variation       7527
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:766065502"
     variation       7531
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1482751047"
     variation       7533
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:914485703"
     variation       7534
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:753744351"
     variation       7536
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:372356560"
     variation       7543
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:764912468"
     variation       7546
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:145140872"
     variation       7551
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1337977662"
     variation       7552
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:116623673"
     variation       7553
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:928356195"
     variation       7557
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1311174434"
     variation       7559
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:569523562"
     variation       7560
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:186794327"
     variation       7561
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1565642151"
     variation       7562
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1346266225"
     variation       7569
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1216381943"
     variation       7570
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:757845073"
     variation       7571
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1312989990"
     variation       7575
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1489399224"
     variation       7577
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:577051130"
     variation       7583
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1194723044"
     variation       7585
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1266933346"
     variation       7587
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:781537142"
     variation       7591
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1036743578"
     variation       7594
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:267602392"
     variation       7597
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:746165255"
     variation       7598
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:770159087"
     variation       7599
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:143162487"
     variation       7604
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:763545893"
     variation       7605
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:768585905"
     variation       7606
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:774537634"
     variation       7608
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:760516162"
     variation       7609
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:147830187"
     variation       7612
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1384589949"
     variation       7623
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:868858086"
     variation       7625
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:776710818"
     variation       7626
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:552066251"
     variation       7629..7641
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="aagaagaaga"
                     /replace="aagaagaagaaga"
                     /replace="aagaagaagaagaaga"
                     /db_xref="dbSNP:763225454"
     variation       7630
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1239985315"
     variation       7640
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:571963100"
     variation       7642
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:907564066"
     variation       7643
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:762718237"
     variation       7646
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:763502836"
     variation       7654
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:940269349"
     exon            7655..7715
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /inference="alignment:Splign:2.1.0"
     variation       7661
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:776350847"
     variation       7664
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:755319544"
     variation       7678
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:765550124"
     variation       7679
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:577237580"
     variation       7680
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:192448554"
     variation       7683
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1325364389"
     variation       7686
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200244150"
     variation       7687
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:141312062"
     variation       7688
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1052019119"
     variation       7690
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1243462986"
     variation       7692
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:911861882"
     variation       7693
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1565655710"
     variation       7699
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:779997033"
     variation       7702
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:749217706"
     variation       7705
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1382353255"
     variation       7706
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1430079078"
     variation       7708
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1178012692"
     variation       7711
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:768469173"
     variation       7713
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:778624614"
     exon            7716..7917
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /inference="alignment:Splign:2.1.0"
     variation       7717
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1593462190"
     variation       7718
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:879004195"
     variation       7719
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:767624278"
     variation       7721
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:142595789"
     variation       7722
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:971377205"
     variation       7723
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1051132992"
     variation       7729
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:756220208"
     variation       7730
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:373229304"
     variation       7731
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1168974129"
     variation       7734
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:116132466"
     variation       7739
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1213747876"
     variation       7743
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:758150082"
     variation       7744
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1438338538"
     variation       7748
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:746649237"
     variation       7751
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1364796890"
     variation       7757
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1472673300"
     variation       7760
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:908637736"
     variation       7762
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201442031"
     variation       7763
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:780903530"
     variation       7772
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:139131571"
     variation       7775
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:377572872"
     variation       7778
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1330722147"
     variation       7796
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:769368467"
     variation       7802
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:749854819"
     variation       7804
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:538432507"
     variation       7805
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:774916657"
     variation       7811
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1243751002"
     variation       7815
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:898397711"
     variation       7816
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:34944231"
     variation       7817
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:767565546"
     variation       7819
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1256793659"
     variation       7821
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:150404273"
     variation       7827
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:766476440"
     variation       7832
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1453396717"
     variation       7833
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1251833616"
     variation       7834
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:752599030"
     variation       7836
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:758378142"
     variation       7841
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1420340279"
     variation       7855
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1376263819"
     variation       7858
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:370266697"
     variation       7859
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:35095099"
     variation       7861
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1376331548"
     variation       7864
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:375024095"
     variation       7865
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:745566133"
     variation       7867
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:755658158"
     variation       7868
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:149645012"
     variation       7872
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:749802502"
     variation       7876
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:866276961"
     variation       7879
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1395262725"
     variation       7880
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:769356942"
     variation       7886
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1565662328"
     variation       7889..7895
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="cgagacc"
                     /replace="cgagaccgagacc"
                     /db_xref="dbSNP:1371086471"
     variation       7889
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:774923755"
     variation       7891
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:748401716"
     variation       7893
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1013086937"
     variation       7895
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1277178257"
     variation       7898
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:772504256"
     variation       7900
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:868356760"
     variation       7903
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:773263407"
     variation       7906
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:760995785"
     variation       7908
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1344881290"
     variation       7915
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1199102821"
     variation       7917
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:766423134"
     exon            7918..7979
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /inference="alignment:Splign:2.1.0"
     variation       7922
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:771981610"
     variation       7923
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:956752475"
     variation       7928
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1473981288"
     variation       7930
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:773293574"
     variation       7935
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1565690430"
     variation       7936
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:867288575"
     variation       7937
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:146144060"
     variation       7939
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:373895280"
     variation       7940
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:753506322"
     variation       7942
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1356739937"
     variation       7945
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1589724786"
     variation       7949
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:750288599"
     variation       7951
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:759309486"
     variation       7953
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1407206360"
     variation       7954
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:12268154"
     variation       7957
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1467568269"
     variation       7966
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1302564812"
     variation       7969
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:764639479"
     variation       7970
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:752316295"
     variation       7972
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:757848963"
     variation       7976
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1589725058"
     variation       7977
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1317421107"
     exon            7980..8095
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /inference="alignment:Splign:2.1.0"
     variation       7981
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:779179692"
     variation       7983
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:552517660"
     variation       7985
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:771056377"
     variation       7986
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:776714808"
     variation       7988
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:138976635"
     variation       7989
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:373262025"
     variation       7990
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1236227348"
     variation       7992
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1303801895"
     variation       7993
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:376832058"
     variation       7994
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:762563927"
     variation       7996
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:369295547"
     variation       7997
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:773920791"
     variation       7998
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1447130895"
     variation       8003
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1212473116"
     variation       8006
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:761319926"
     variation       8007
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:748599613"
     variation       8012
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1589742133"
     variation       8020
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1268085020"
     variation       8027
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1435239520"
     variation       8029
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1194666228"
     variation       8030
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1268502166"
     variation       8032
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1453432073"
     variation       8034
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1185556095"
     variation       8041
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1363639492"
     variation       8042
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:767958887"
     variation       8045
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:142125896"
     variation       8046
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:147714181"
     variation       8054
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:114701221"
     variation       8055
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:534941686"
     variation       8060
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:373168589"
     variation       8061
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:139196844"
     variation       8064
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:188626786"
     variation       8065
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:115880388"
     variation       8067
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:781226002"
     variation       8069
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1334995033"
     variation       8074
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:745833341"
     variation       8076
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:543630960"
     variation       8077
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1350887064"
     variation       8078
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:779772714"
     variation       8079
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1270664849"
     variation       8080
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:61730787"
     variation       8081
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:774010181"
     variation       8083
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:922043946"
     variation       8084
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1436479863"
     variation       8086
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:772560651"
     variation       8087
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:771598263"
     variation       8088
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:377342486"
     variation       8089
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:761132977"
     exon            8096..8267
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /inference="alignment:Splign:2.1.0"
     variation       8096
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1589754619"
     variation       8104
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:761236862"
     variation       8108
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:771274057"
     variation       8114
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:914900340"
     variation       8118
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:777206576"
     variation       8119
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1589754763"
     variation       8124
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:969334372"
     variation       8125
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:564397839"
     variation       8128
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1288294653"
     variation       8129
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:775833159"
     variation       8131..8137
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="ctgc"
                     /replace="ctgctgc"
                     /db_xref="dbSNP:1230344014"
     variation       8133
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1271256611"
     variation       8134
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:763325586"
     variation       8136
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:764232214"
     variation       8137
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:111666066"
     variation       8138
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:751529875"
     variation       8140
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1233166862"
     variation       8149
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:757374526"
     variation       8152
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1259806348"
     variation       8154
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:766182197"
     variation       8159
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:753808693"
     variation       8160
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:754732462"
     variation       8161
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1453598568"
     variation       8172
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:778724348"
     variation       8177
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:376976062"
     variation       8183
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:371140295"
     variation       8187
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:777485343"
     variation       8188
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:746443975"
     variation       8192..8195
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="gcag"
                     /db_xref="dbSNP:1382193243"
     variation       8192
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:770495746"
     variation       8193
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:776962329"
     variation       8194
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1370858692"
     variation       8196
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200541273"
     variation       8202
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:770269399"
     variation       8203
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:577886780"
     variation       8207
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1359145924"
     variation       8212
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1238683112"
     variation       8215
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:930801970"
     variation       8217
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1004976434"
     variation       8222
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1203463385"
     variation       8223
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1565704868"
     variation       8226
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:763416174"
     variation       8229
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:775393485"
     variation       8231..8233
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="cat"
                     /replace="catcat"
                     /db_xref="dbSNP:1248601100"
     variation       8236
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1467925153"
     variation       8240
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:201932773"
     variation       8241
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1589755909"
     variation       8242
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:114249776"
     variation       8243
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1267979086"
     variation       8244
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:761762767"
     variation       8245
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:528927715"
     variation       8247
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:753749581"
     variation       8253
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1361658773"
     variation       8257
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:150511831"
     variation       8258
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:944965247"
     variation       8261
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1394419746"
     exon            8268..8408
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /inference="alignment:Splign:2.1.0"
     variation       8269
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1292604781"
     variation       8271
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:765099062"
     variation       8272
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201040344"
     variation       8273
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1291974723"
     variation       8274
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:912402928"
     variation       8275
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:762614578"
     variation       8276
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:763989975"
     variation       8277
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:542534555"
     variation       8281
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1182505507"
     variation       8284
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1256343345"
     variation       8290
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:762526471"
     variation       8296
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:780998441"
     variation       8300
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:61753076"
     variation       8301
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:185164847"
     variation       8303..8309
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="cctc"
                     /replace="cctcctc"
                     /db_xref="dbSNP:1564726084"
     variation       8306
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:749844633"
     variation       8307
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1356683962"
     variation       8309
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1564726248"
     variation       8311
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1313969799"
     variation       8315
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:768884400"
     variation       8316
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1430780689"
     variation       8318
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:779388403"
     variation       8322
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:748310126"
     variation       8323
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1589768953"
     variation       8327
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:569372372"
     variation       8328
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:773434164"
     variation       8338
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:138735982"
     variation       8339
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:771028132"
     variation       8340
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1293319065"
     variation       8341
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:775373741"
     variation       8343
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1002413226"
     variation       8350
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace=""
                     /replace="a"
                     /db_xref="dbSNP:751739873"
     variation       8353
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1279203734"
     variation       8363
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:762996567"
     variation       8364
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:763792326"
     variation       8366
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:751302440"
     variation       8367
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1474776848"
     variation       8371
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:761527720"
     variation       8374
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1392517494"
     variation       8375
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200089235"
     variation       8377
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1450511448"
     variation       8381
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:147846497"
     variation       8383
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1393510937"
     variation       8385
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1436876678"
     variation       8386
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:755658202"
     variation       8389
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1344731089"
     variation       8390
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1428702141"
     variation       8393
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:754283055"
     variation       8394
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:539421583"
     variation       8396
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1444411645"
     variation       8405
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:779289414"
     variation       8407
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1302344524"
     exon            8409..8498
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /inference="alignment:Splign:2.1.0"
     variation       8411
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1414468282"
     variation       8412..8422
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="gagtt"
                     /replace="gagttagagtt"
                     /db_xref="dbSNP:767240818"
     variation       8417
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="aa"
                     /db_xref="dbSNP:750417298"
     variation       8418
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1336186671"
     variation       8424
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:771984054"
     variation       8425
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:865827548"
     variation       8429
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1412881261"
     variation       8433
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:567347253"
     variation       8434
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:760546620"
     variation       8435
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1388437775"
     variation       8436
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:992998683"
     variation       8437
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:765996074"
     variation       8438
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:532141781"
     variation       8454
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1334932533"
     variation       8456
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:776167726"
     variation       8458
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1289795919"
     variation       8461
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1350620257"
     variation       8463
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1232104837"
     variation       8466
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:376705581"
     variation       8469
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1271866439"
     variation       8471
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1564735508"
     variation       8478
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:759045351"
     variation       8479
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:764692213"
     variation       8482
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:375657472"
     variation       8486
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:753223988"
     variation       8487
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1436428056"
     variation       8490
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1589779582"
     variation       8491
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1589779626"
     variation       8497
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:758961340"
     exon            8499..8642
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /inference="alignment:Splign:2.1.0"
     variation       8503
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1300712545"
     variation       8504
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:141377067"
     variation       8509
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1396085567"
     variation       8512
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1484129399"
     variation       8518
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:767823235"
     variation       8521
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:750641625"
     variation       8522
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:145232984"
     variation       8523
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2295878"
     variation       8527
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:867736580"
     variation       8529
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:753914817"
     variation       8536
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1232416465"
     variation       8539
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:755134815"
     variation       8540
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1007551291"
     variation       8541
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:777816912"
     variation       8543
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:746985859"
     variation       8546
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:770738881"
     variation       8551
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:148958039"
     variation       8552
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:745530967"
     variation       8553
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:776539571"
     variation       8554
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:759597676"
     variation       8556
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:775145955"
     variation       8558
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:762408075"
     variation       8559
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:61753077"
     variation       8560
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:866260474"
     variation       8564
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:762281778"
     variation       8565
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:2295879"
     variation       8567
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:761809326"
     variation       8572
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1176369997"
     variation       8573..8574
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="gg"
                     /db_xref="dbSNP:747741502"
     variation       8575
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1370782961"
     variation       8580
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:766663899"
     variation       8583
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1368553884"
     variation       8588
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:536628094"
     variation       8598
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:866691058"
     variation       8604
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:755079853"
     variation       8606
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:765459460"
     variation       8607
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:75671139"
     variation       8610
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:145179415"
     variation       8616
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1252684363"
     variation       8619
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:139008883"
     variation       8620
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1336971324"
     variation       8622
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:745600319"
     variation       8630
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1268666853"
     variation       8631
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:538968585"
     variation       8634
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1189176188"
     variation       8637
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1449661928"
     variation       8638
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:779648529"
     variation       8641
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1448067248"
     variation       8642
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:748986288"
     exon            8643..8719
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /inference="alignment:Splign:2.1.0"
     variation       8643
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:747566067"
     variation       8650
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:771648191"
     variation       8651
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:369002161"
     variation       8654
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1564793181"
     variation       8657
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:975775977"
     variation       8662
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1291433586"
     variation       8670
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1377060915"
     variation       8683
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:747603637"
     variation       8690
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:912316468"
     variation       8699
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:771411616"
     variation       8701
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:372697264"
     variation       8708
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1227342028"
     variation       8709
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:978317426"
     exon            8720..8763
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /inference="alignment:Splign:2.1.0"
     variation       8720
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1564820315"
     variation       8721
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:75080758"
     variation       8722
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:370762796"
     variation       8723
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:746194917"
     variation       8725
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:770322124"
     variation       8732
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:775552173"
     variation       8735
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:142193513"
     variation       8740
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1423272950"
     variation       8741
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:867489356"
     variation       8750
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:768612291"
     variation       8754
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1176806548"
     variation       8757
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:774419561"
     variation       8760
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:761890514"
     variation       8762
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1318429487"
     exon            8764..8924
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /inference="alignment:Splign:2.1.0"
     variation       8765
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1478990548"
     variation       8768
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:368788180"
     variation       8769
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:762669751"
     variation       8777
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1414112797"
     variation       8780
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:267602393"
     variation       8782
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1470506018"
     variation       8784
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:763754108"
     variation       8786
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:751297161"
     variation       8789
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1406827536"
     variation       8791
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1226848799"
     variation       8792
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:756806235"
     variation       8794
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1019037833"
     variation       8797
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1407465849"
     variation       8798
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1309376878"
     variation       8800
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:576383974"
     variation       8802
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:750960872"
     variation       8812
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:756574052"
     variation       8834
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1358939475"
     variation       8835
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:780436891"
     variation       8840
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:545114672"
     variation       8852
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201589274"
     variation       8853
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:146365438"
     variation       8865
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1252717696"
     variation       8870
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:114739516"
     variation       8871
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:772127891"
     variation       8879
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:527587471"
     variation       8886
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:747065222"
     variation       8887..8892
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="atgaga"
                     /db_xref="dbSNP:1589963303"
     variation       8888
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:149487619"
     variation       8896
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:143941520"
     variation       8897
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1343531337"
     variation       8903
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:762769351"
     variation       8906
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1170065040"
     variation       8907
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1589963486"
     variation       8909
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1396657872"
     variation       8911
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:763843707"
     variation       8915
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:774133362"
     variation       8919
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:761622230"
     variation       8920
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:767282216"
     variation       8921
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:749892480"
     variation       8922
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:755599004"
     exon            8925..9031
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /inference="alignment:Splign:2.1.0"
     variation       8933
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:760029955"
     variation       8942
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:765741125"
     variation       8944
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1190199335"
     variation       8947
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1262009486"
     variation       8950
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1432296611"
     variation       8951
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:753003533"
     variation       8954
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1564874083"
     variation       8957
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:758787417"
     variation       8959
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1480448917"
     variation       8961
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1159111751"
     variation       8965
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:777932612"
     variation       8967
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:751771255"
     variation       8968
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:372413580"
     variation       8981
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:781195910"
     variation       8995
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1385348085"
     variation       9000
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1303647079"
     variation       9006
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1237279577"
     variation       9010
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:745963821"
     variation       9011
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:554081729"
     variation       9013
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:779013734"
     variation       9014
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:376082640"
     variation       9023
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1213968702"
     variation       9024
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:772029008"
     variation       9026
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1406473528"
     variation       9027
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1261162550"
     variation       9029
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1488018630"
     exon            9032..9152
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /inference="alignment:Splign:2.1.0"
     variation       9037
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:746827175"
     variation       9049
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:770435787"
     variation       9050
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1309438773"
     variation       9052
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:776369229"
     variation       9058
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1564879870"
     variation       9059
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1177930005"
     variation       9064
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:547685475"
     variation       9065
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:567661733"
     variation       9066
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:745678131"
     variation       9070
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1316975899"
     variation       9071
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1359848003"
     variation       9081
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1227277077"
     variation       9082
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:763517853"
     variation       9083
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:368557628"
     variation       9084
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:114931291"
     variation       9087
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:750694570"
     variation       9088
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1482596204"
     variation       9095
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:373294737"
     variation       9097
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:56075957"
     variation       9098
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:915433777"
     variation       9101
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:934534722"
     variation       9102
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1449221633"
     variation       9103
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1186937744"
     variation       9104
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:752680886"
     variation       9111
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1410614727"
     variation       9118
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:758346924"
     variation       9120
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1357493288"
     variation       9121
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1464517939"
     variation       9123
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:777783896"
     variation       9124
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1383284248"
     variation       9125
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:780060707"
     variation       9126
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:757107024"
     variation       9127
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1363564488"
     variation       9131
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:780680174"
     variation       9133
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1589974709"
     variation       9138
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:745570983"
     variation       9139
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:769288113"
     variation       9140
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:201638112"
     variation       9141
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1166152334"
     variation       9147
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:376457806"
     exon            9153..9704
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /inference="alignment:Splign:2.1.0"
     variation       9153
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1564914901"
     variation       9161
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1276851285"
     variation       9163
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1220908859"
     variation       9175
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:768248413"
     variation       9188
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:779260986"
     variation       9189
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1311935453"
     variation       9191
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:748744464"
     variation       9194
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:772316313"
     variation       9201
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:773647485"
     variation       9213
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1360412716"
     variation       9217
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:771233836"
     variation       9219
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:866915985"
     variation       9221
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:777028253"
     variation       9222
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:902027065"
     variation       9224
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1172721621"
     variation       9227
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:759504397"
     variation       9228
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:377142183"
     variation       9231
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1351888215"
     variation       9232
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1416840704"
     variation       9234
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1187544287"
     variation       9242
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:751439925"
     variation       9243
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:547512577"
     variation       9245
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1361936110"
     variation       9249
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1223497421"
     variation       9251
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:3763763"
     variation       9252
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:750169900"
     variation       9257
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:755933143"
     variation       9259
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1234496958"
     variation       9264
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:374823698"
     variation       9265
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:777282532"
     variation       9266
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1201048578"
     variation       9267
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:753572151"
     variation       9268
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1006629992"
     variation       9270
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:754430244"
     variation       9272
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:778549316"
     variation       9273
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1369424351"
     variation       9278
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:747619110"
     variation       9279
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:772575740"
     variation       9285
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:778450017"
     variation       9292
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1046622000"
     variation       9294
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1447930166"
     variation       9296
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1282865623"
     variation       9301
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:747341499"
     variation       9304
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:771462938"
     variation       9307
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:759862926"
     variation       9309
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:769760312"
     variation       9312
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:775580610"
     variation       9316
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1275047558"
     variation       9319
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:181521772"
     variation       9320
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:569504865"
     variation       9323
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:750399176"
     variation       9324
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:959269055"
     variation       9325
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1446174545"
     variation       9332
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1416315388"
     variation       9335..9337
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="tt"
                     /replace="ttt"
                     /db_xref="dbSNP:1183854936"
     variation       9335
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1389099504"
     variation       9344..9351
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="taaa"
                     /replace="taaataaa"
                     /db_xref="dbSNP:751463672"
     variation       9345..9353
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="aaat"
                     /replace="aaataaaat"
                     /db_xref="dbSNP:774569712"
     variation       9348
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1169201175"
     variation       9352
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:760437099"
     variation       9354
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:766216318"
     variation       9357..9359
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="tt"
                     /replace="ttt"
                     /db_xref="dbSNP:1458552102"
     variation       9357
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1272959843"
     variation       9359
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:753425741"
     variation       9360
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1219898335"
     variation       9369
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:748877620"
     variation       9371
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1408793518"
     variation       9380..9382
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace=""
                     /replace="aga"
                     /db_xref="dbSNP:1453790729"
     variation       9384
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="t"
                     /replace="tt"
                     /db_xref="dbSNP:762007046"
     variation       9385
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1363223209"
     variation       9389
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1024739984"
     variation       9401
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1374062655"
     variation       9417
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:966946959"
     variation       9419
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:977836267"
     variation       9422
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1270884083"
     variation       9429
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1344366660"
     variation       9437
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1199822541"
     variation       9452
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:778446734"
     variation       9453
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1462490128"
     variation       9456
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1590027493"
     variation       9458
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1370234122"
     variation       9460
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1203996663"
     variation       9465
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1247168452"
     variation       9466
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1291714220"
     variation       9478
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1036258557"
     variation       9483
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1459287529"
     variation       9492
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:898819681"
     variation       9506
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1224122716"
     variation       9513
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1165778617"
     variation       9515
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:778166644"
     variation       9522
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1419286233"
     variation       9528
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1262422910"
     variation       9532
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1180522218"
     variation       9535
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1440380617"
     variation       9557
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1321148976"
     variation       9563
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1189949768"
     variation       9564
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1028662571"
     variation       9567
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1305248145"
     variation       9571
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1032499439"
     variation       9573
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1350982712"
     variation       9581
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1287705618"
     variation       9583
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace=""
                     /replace="t"
                     /db_xref="dbSNP:878864233"
     variation       9584
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:15151"
     variation       9589
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1240327071"
     variation       9592..9594
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace=""
                     /replace="aag"
                     /db_xref="dbSNP:957852098"
     variation       9598
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:747511945"
     variation       9599
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1388396106"
     variation       9608
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1368077329"
     variation       9610
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:770390619"
     variation       9614
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:185822401"
     variation       9619
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:558060686"
     variation       9620
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:967563460"
     variation       9627..9631
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="tttt"
                     /replace="ttttt"
                     /replace="tttttttt"
                     /db_xref="dbSNP:910920936"
     variation       9632..9638
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="aaaaaaa"
                     /replace="aaaaaaaa"
                     /db_xref="dbSNP:112509232"
     variation       9632
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:191421130"
     variation       9633
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:976351124"
     variation       9636
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1160673944"
     variation       9640
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1420425324"
     variation       9645
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1590028621"
     variation       9647
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="gg"
                     /db_xref="dbSNP:35785098"
     variation       9649
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:977657785"
     variation       9650
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1174596543"
     variation       9665..9678
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="t"
                     /replace="tctctattgtaaat"
                     /db_xref="dbSNP:1435360193"
     variation       9667
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1268515894"
     variation       9668
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1193473691"
     variation       9680
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1487511484"
     variation       9682
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:929454719"
     variation       9683
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1033234149"
     variation       9697
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1047929684"
     variation       9701
                     /gene="TACC2"
                     /gene_synonym="AZU-1; ECTACC"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:147236944"
ORIGIN      
ataagtggacagcctgctccaagggaaggatcaggagagaagaaacgcaaatcccagaaccgtgccaacatataaaaccccacattaagggttgtacagtgcactgggatttctcaagtcacccgcttggtcctcttccaagtatactttacttcctttcattcctctctaaaacttttttaaaaactttcactcctgctctaaaagttatcttggtttcttactctaccttatgccccttgggcgaattttttcctctgaggagggaagaatagagttgctgctgcagacacatcagattccctactggtaacagctggagtgcgtcacctctgacaaaattctggggacgctgggaacactgaatcaacatgggcaatgagaacagcacctcggacaaccagaggactttatcagctcagactccaaggtccgcgcagccacccgggaacagtcagaatataaaaaggaagcagcaggacacgcccggaagccctgaccacagagacgcgtccagcattggcagcgttgggcttggaggcttctgcaccgcttctgagagttctgccagcctggatccatgccttgtgtccccagaggtgactgagccaaggaaggacccacagggagccagggggccagaaggttctttgctgcccagcccaccaccgtcccaggagcgagagcacccctcgtcctccatgccctttgccgagtgtcccccggaaggttgcttggcaagtccagcagcggcacctgaagatggtcctcagactcagtctcccaggagggaacctgccccaaatgccccaggagacatcgcggcggcatttcccgctgagagggacagctctactccataccaagagattgctgccgtccccagtgctggaagagagagacagccgaaggaagaaggacagaagtcctccttctccttctccagtggcatcgaccagtcacctggaatgtcgccagtacccctcagagagccaatgaaggcaccgctgtgtggagagggggaccagcctggtggttttgagtcccaagagaaagaggctgcaggtggctttccccctgcagagtccaggcagggggtggcttctgtgcaagtgacccctgaggcccctgctgcagcccagcagggcacagaaagctcagcggtcttggagaagtcccccctaaaacccatggccccgatcccacaagatccagccccaagagcctcagacagagaaagaggccaaggggaggcgccgcctcagtatttaacagatgacttggaattcctcagggcctgccatctccctaggagcaattcaggggctgccccagaagcagaagtgaatgccgcttcccaggagagctgccagcagccagtgggagcatatctgccgcacgcagagctgccctggggcttgccaagtcctgccctggtgccagaggctgggggctctgggaaggaggctctggacaccattgatgttcagggtcacccacagacagggatgcgaggaaccaagcccaatcaagttgtctgtgtggcagcaggcggccagcccgaagggggtttgcctgtgagccctgaaccttccctgctcactccgactgaggaagcacatccagcttcaagcctcgcttcattcccagctgctcagattcctattgctgtagaagaacctggatcatcatccagggaatcagtttccaaggctgggatgccagtttctgcagatgcagccaaagaggtggtggatgcagggttggtgggactggagaggcaggtgtcagatcttggaagcaagggagagcatccagaaggggaccctggagaggttcctgccccatcaccccaggagaggggagagcacttgaacacggagcaaagccatgaggtccaaccaggagtaccaccccctcctcttcccaaggagcaaagccatgaggtccaaccaggagcaccaccccctcctcttcccaaggcaccaagtgaaagtgccagagggccaccggggccaacggatggagccaaggtccatgaagattccacaagcccagccgtggctaaagaaggaagcagatcacctggtgacagccctggaggaaaggaggaagccccagagccacctgatggtggagacccagggaacctgcaaggagaggactctcaggctttcagcagcaagcgtgatccagaagtaggcaaagatgagctttcaaagccaagcagtgatgcagagagcagagaccatcccagctcacactcagcacagccacccagaaaggggggtgctgggcacacggacgggccccactctcagacagcagaggctgatgcatctggcctaccacacaagctgggtgaggaggaccccgtcctgccccctgtgccagatggagctggtgagcccactgttcccgaaggagccatctgggaggggtcaggattgcagcccaaatgtcctgacacccttcagagcagggaaggattgggaagaatggagtctttcctgactttagaatcagagaaatcagattttccaccaactcctgttgcagaggttgcacccaaagcccaggaaggtgagagcacattggaaataaggaagatgggcagctgtgatggggagggcttgctgacgtccccagatcaaccccgcgggccggcgtgtgatgcgtcgagacaggaatttcatgctggggtgccacatcccccccagggggagaacttggcagcagacctggggctcacggcactcatcctggaccaagatcagcagggaatcccatcctgcccaggggaaggctggataagaggagctgcatccgagtggcccctactatcttctgagaagcatctccagccatcccaggcacaaccagagacatccatctttgacgtgctcaaggagcaggcccagccacctgaaaatgggaaagagacttctccaagccatccaggttttaaggaccagggagcagattcttcccaaatccatgtacctgtggaacctcaggaagataacaacttgcccactcatggaggacaggagcaggctttgggatcagaacttcaaagtcagctccccaaaggcaccctgtctgatactccaacttcatctcccactgacatggtttgggagagttctctgacagaagagtcagaattgtcagcaccaacgagacagaagttgcctgcactaggggagaagcggccagagggagcatgcggtgatggtcagtcctcgagggtctcgcctccagcagcagatgtcttaaaagacttttctcttgcagggaacttcagcagaaaggaaacttgctgcactgggcaggggccaaacaagtctcaacaggcattggctgatgccttggaagaaggcagccagcatgaagaagcatgtcaaaggcatccaggagcttctgaagcagctgatggttgttccccactctggggcttgagtaagagggagatggcaagtggaaacacaggggaggccccaccttgtcagcctgactcagtagctctcctggatgcagttccctgcctgccagccctggcgcccgccagccccggagtcacacccacccaggatgccccagagacagaggcatgtgatgaaacccaggaaggcaggcagcaaccagtgccggccccgcagcagaaaatggagtgctgggccacttcggatgcagagtccccaaagcttcttgcaagtttcccatcagctggggagcaaggtggtgaagccggggctgctgagactggtggcagcgctggtgcaggagacccaggaaagcagcaggctccggagaaacctggagaagctactttgagttgtggcctccttcagactgagcactgccttacctccggggaggaagcttctacctctgccctacgtgagtcctgccaagctgagcaccccatggccagctgccaggatgccttgctgccagccagagagctgggtgggattcccaggagcaccatggatttttctacacaccaggctgtcccagacccaaaggagctcctgctgtctgggccaccagaagtggctgctcctgacaccccttacctgcatgtcgacagtgctgcccagagaggagcagaagacagtggagtgaaagctgtttcctctgcagaccccagagctcctggcgaaagcccctgtcctgtaggggagcccccacttgccttggaaaatgctgcctccttgaagctgtttgctggctccctcgcccccctgttgcaaccaggagctgcaggtggggaaatccctgcagtgcaagccagcagtggtagtcccaaagccagaaccactgagggaccagtggactccatgccatgcctggaccggatgccacttctggccaagggcaagcaggcaacaggggaagagaaagcagcaacagctccaggtgcaggtgccaaggccagtggggagggcatggcaggtgatgcagcaggagagacagagggcagcatggagaggatgggagagccttcccaggacccaaagcagggcacatcaggtggtgtggacacaagctctgagcaaatcgccaccctcactggcttcccagacttcagggagcacatcgccaagatcttcgagaagcctgtgctcggagccctggccacacctggagaaaaggcaggagctgggaggagtgcagtgggtaaagacctcaccaggccattgggcccagagaagcttctagatgggcctccaggagtggatgtcacccttctccctgcacctcctgctcgactccaggtggagaagaagcaacagttggctggagaggctgagatttcccatctggctctgcaagatccagcttcagacaagcttctgggtccagcagggctgacctgggagcggaacttgccaggtgccggtgtggggaaggagatggcaggtgtcccacccacactgagggaagacgagaggccagaggggcctggggcagcctggccaggcctggaaggccaggcttactcacagctggagaggagcaggcaggaattagcttcaggtcttccttcaccagcagctactcaggagctccctgtggagagagctgctgccttccaggtggctccccatagccatggagaagaggccgtggcccaagacagaattccttctggaaagcagcaccaggaaacatctgcctgcgacagtccacatggagaagatggtcccggggactttgctcacacaggggttccaggacatgtgccaaggtccacgtgtgccccttctcctcagagggaggttttgactgtgcctgaggccaacagtgagccctggacccttgacacgcttgggggtgaaaggagacccggagtcactgctggcatcttggaaatgcgaaatgccctgggcaaccagagcacccctgcaccaccaactggagaagtggcagacactcccctggagcctggcaaggtggcaggcgctgctggggaagcagagggtgacatcaccctgagcacagctgagacacaggcatgtgcgtccggtgatctgcctgaagcaggtactacgaggacattctccgttgtggcaggtgacttggtgctgccaggaagctgtcaggacccagcctgctctgacaaggctccggggatggagggtacagctgcccttcatggggacagcccagccaggccccagcaggctaaggagcagccagggcctgagcgccccattccagctggggatgggaaggtgtgcgtctcctcacctccagagcctgacgaaactcacgacccgaagctgcaacatttggctccagaagagctccacactgacagagagagccccaggcctggcccatccatgttaccttcggttcctaagaaggatgctccaagagtcatggataaagtcacttcagatgagaccagaggtgcggaaggaacagaaagttcacctgtggcagatgatatcatccagcccgctgcccccgcagacctggaaagcccaaccttagctgcctcttcctaccacggtgatgttgttggccaggtctctacggatctgatagcccagagcatctccccagctgctgcccatgcgggtcttcctccctcggctgcagaacacatagtttcgccatctgccccagctggtgacagagtagaagcttccactccctcctgcccagatccggccaaggacctcagcaggagttccgattctgaagaggcatttgagaccccggagtcaacgacccctgtcaaagctccgccagctccacccccaccaccccccgaagtcatcccagaacccgaggtcagcacacagccacccccggaagaaccaggatgtggttctgagacagtccctgtccctgatggcccacggagcgactcggtggaaggaagtcccttccgtcccccgtcacactccttctctgccgtcttcgatgaagacaagccgatagccagcagtgggacttacaacttggactttgacaacattgagcttgtggatacctttcagaccttggagcctcgtgcctcagacgctaagaatcaggagggcaaagtgaacacacggaggaagtccacggattccgtccccatctctaagtctacactgtcccggtcgctcagcctgcaagccagtgactttgatggtgcttcttcctcaggcaatcccgaggccgtggcccttgccccagatgcatatagcacgggttccagcagtgcttctagtacccttaagcgaactaaaaaaccgaggccgccttccttaaaaaagaaacagaccaccaagaaacccacagagacccccccagtgaaggagacgcaacaggagccagatgaagagagccttgtccccagtggggagaatctagcatctgagacgaaaacggaatctgccaagacggaaggtcctagcccagccttattggaggagacgccccttgagcccgctgtggggcccaaagctgcctgccctctggactcagagagtgcagaaggggttgtccccccggcttctggaggtggcagagtgcagaactcaccccctgtcgggaggaaaacgctgcctcttaccacggccccggaggcaggggaggtaaccccatcggatagcggggggcaagaggactctccagccaaagggctctccgtaaggctggagtttgactattctgaggacaagagtagttgggacaaccagcaggaaaacccccctcctaccaaaaagataggcaaaaagccagttgccaaaatgcccctgaggaggccaaagatgaaaaagacacccgagaaacttgacaacactcctgcctcacctcccagatcccctgctgaacccaatgacatccccattgctaaaggtacttacacctttgatattgacaagtgggatgaccccaattttaaccctttttcttccacctcaaaaatgcaggagtctcccaaactgccccaacaatcatacaactttgacccagacacctgtgatgagtccgttgacccctttaagacatcctctaagacccccagctcaccttctaaatccccagcctcctttgagatcccagccagtgctatggaagccaatggagtggacggggatgggctaaacaagcccgccaagaagaagaagacgcccctaaagactgacacatttagggtgaaaaagtcgccaaaacggtctcctctctctgatccaccttcccaggaccccaccccagctgctacaccagaaacaccaccagtgatctctgcggtggtccacgccacagatgaggaaaagctggcggtcaccaaccagaagtggacgtgcatgacagtggacctagaggctgacaaacaggactacccgcagccctcggacctgtccacctttgtaaacgagaccaaattcagttcacccactgaggagttggattacagaaactcctatgaaattgaatatatggagaaaattggctcctccttacctcaggacgacgatgccccgaagaagcaggccttgtaccttatgtttgacacttctcaggagagccctgtcaagtcatctcccgtccgcatgtcagagtccccgacgccgtgttcagggtcaagttttgaagagactgaagcccttgtgaacactgctgcgaaaaaccagcatcctgtcccacgaggactggcccctaaccaagagtcacacttgcaggtgccagagaaatcctcccagaaggagctggaggccatgggcttgggcaccccttcagaagcgattgaaattacagctcccgagggctcctttgcctctgctgacgccctcctcagcaggctagctcaccccgtctctctctgtggtgcacttgactatctggagcccgacttagcagaaaagaaccccccactattcgctcagaaactccaggaggagttagagtttgccatcatgcggatagaagccctgaagctggccaggcagattgctttggcttcccgcagccaccaggatgccaagagagaggctgctcacccaacagacgtctccatctccaaaacagccttgtactcccgcatcgggaccgctgaggtggagaaacctgcaggccttctgttccagcagcccgacctggactctgccctccagatcgccagagcagagatcataaccaaggagagagaggtctcagaatggaaagataaatatgaagaaagcaggcgggaagtgatggaaatgaggaaaatagtggccgagtatgagaagaccatcgctcagatgatagaggacgaacagagagagaagtcagtctcccaccagacggtgcagcagctggttctggagaaggagcaagccctggccgacctgaactccgtggagaagtctctggccgacctcttcagaagatatgagaagatgaaggaggtcctagaaggcttccgcaagaatgaagaggtgttgaagagatgtgcgcaggagtacctgtcccgggtgaagaaggaggagcagaggtaccaggccctgaaggtgcacgcggaggagaaactggacagggccaatgctgagattgctcaggttcgaggcaaggcccagcaggagcaagccgcccaccaggccagcctgcggaaggagcagctgcgagtggacgccctggaaaggacgctggagcagaagaataaagaaatagaagaactcaccaagatttgtgacgaactgattgccaaaatggggaaaagctaactctgaaccgaatgttttggacttaactgttgcgtgcaatatgaccgtcggcacactgctgttcctccagttccatggacaggttctgttttcactttttcgtatgcactactgtatttcctttctaaataaaattgatttgattgtatgcagtactaaggagactatcagaatttcttgctattggtttgcattttcctagtataattcatagcaagttgacctcagagttcctgtatcagggagattgtctgattctctaataaaagacacattgctgaccttggccttgccctttgtacacaagttcccagggtgagcagcttttggatttaatatgaacatgtacagcgtgcatagggactcttgccttaaggagtgtaaacttgatctgcatttgctgatttgtttttaaaaaaacaagaaatgcatgtttcaaataaaattctctattgtaaataaaattttttctttggatcttggcaa
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]