GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2019-03-23 03:26:49, GGRNA.v2 : RefSeq release 92 (Jan, 2019)

LOCUS       NM_205533               1018 bp    mRNA    linear   VRT 26-JUN-2018
DEFINITION  Gallus gallus H6 family homeobox 1 (HMX1), mRNA.
ACCESSION   NM_205533
VERSION     NM_205533.2
KEYWORDS    RefSeq.
SOURCE      Gallus gallus (chicken)
  ORGANISM  Gallus gallus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Archelosauria; Archosauria; Dinosauria; Saurischia; Theropoda;
            Coelurosauria; Aves; Neognathae; Galloanserae; Galliformes;
            Phasianidae; Phasianinae; Gallus.
REFERENCE   1  (bases 1 to 1018)
  AUTHORS   Schulte D and Cepko CL.
  TITLE     Two homeobox genes define the domain of EphA3 expression in the
            developing chick retina
  JOURNAL   Development 127 (23), 5033-5045 (2000)
   PUBMED   11060230
REFERENCE   2  (bases 1 to 1018)
  AUTHORS   Stadler HS, Murray JC, Leysens NJ, Goodfellow PJ and Solursh M.
  TITLE     Phylogenetic conservation and physical mapping of members of the H6
            homeobox gene family
  JOURNAL   Mamm. Genome 6 (6), 383-388 (1995)
   PUBMED   7647458
REFERENCE   3  (bases 1 to 1018)
  AUTHORS   Stadler HS and Solursh M.
  TITLE     Characterization of the homeobox-containing gene GH6 identifies
            novel regions of homeobox gene expression in the developing chick
            embryo
  JOURNAL   Dev. Biol. 161 (1), 251-262 (1994)
   PUBMED   7904968
COMMENT     VALIDATED REFSEQ: This record has undergone validation or
            preliminary review. The reference sequence was derived from
            AADN05000017.1.
            On Apr 7, 2017 this sequence version replaced NM_205533.1.
            
            Sequence Note: The RefSeq transcript and protein were derived from
            genomic sequence to make the sequence consistent with the reference
            genome assembly. The genomic coordinates used for the transcript
            record were based on alignments.
            
            ##Evidence-Data-START##
            RNAseq introns :: single sample supports all introns SAMEA2201358,
                              SAMEA3109051 [ECO:0000348]
            ##Evidence-Data-END##
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-327               AADN05000017.1     9287328-9287654
            328-1018            AADN05000017.1     9289297-9289987
FEATURES             Location/Qualifiers
     source          1..1018
                     /organism="Gallus gallus"
                     /mol_type="mRNA"
                     /db_xref="taxon:9031"
                     /chromosome="4"
                     /map="4"
                     /breed="Red Jungle Fowl"
     gene            1..1018
                     /gene="HMX1"
                     /gene_synonym="GH6"
                     /note="H6 family homeobox 1"
                     /db_xref="CGNC:11629"
                     /db_xref="GeneID:396546"
     exon            1..327
                     /gene="HMX1"
                     /gene_synonym="GH6"
                     /inference="alignment:Splign:2.1.0"
     CDS             78..899
                     /gene="HMX1"
                     /gene_synonym="GH6"
                     /note="homeo box (H6 family) 1; homeobox protein H6;
                     homeobox (H6 family) 1"
                     /codon_start=1
                     /product="homeobox protein HMX1"
                     /protein_id="NP_990864.2"
                     /db_xref="CGNC:11629"
                     /db_xref="GeneID:396546"
                     /translation="
MPDEATENAGSTSARVSSFFIEDLLGTEGGGGTRRAAAGGGGGRGAPRCGPHSPLRLGASGCPLRDAAVGWYRRAFLGCASPDTSDRDSPELPEDTERAGGGGRAAARGPAGGRQSSGGREEEEERGEEAGEAEQRAAGRKKKTRTVFSRSQVFQLESTFDVKRYLSSSERAGLAASLHLTETQVKIWFQNRRNKWKRQLAADLEAANLSHAAQRIVRVPILYHENSPASALGFGLPHMSPPLVGFSGGVSYPLGTFPAASLPFLRSQMTGLV"
     misc_feature    order(501..515,519..521,570..572,588..590,627..629,
                     633..638,645..650,654..662,666..671)
                     /gene="HMX1"
                     /gene_synonym="GH6"
                     /note="DNA binding site [nucleotide binding]"
                     /db_xref="CDD:238039"
     misc_feature    507..668
                     /gene="HMX1"
                     /gene_synonym="GH6"
                     /note="Homeobox domain; Region: Homeobox; pfam00046"
                     /db_xref="CDD:306543"
     misc_feature    order(507..509,516..518,636..638,645..650,657..659)
                     /gene="HMX1"
                     /gene_synonym="GH6"
                     /note="specific DNA base contacts [nucleotide binding];
                     other site"
                     /db_xref="CDD:238039"
     exon            328..1018
                     /gene="HMX1"
                     /gene_synonym="GH6"
                     /inference="alignment:Splign:2.1.0"
ORIGIN      
ccgcggggcagcggggagccgaggagccatcctccggcggagccgggaccccccctcccgcagctgttttatcgacgatgccggacgaagcgacggaaaacgccggctccacatctgcccgcgtctcgtcctttttcatcgaggacctgctgggcaccgaaggcggcggagggacgcggagggcggcggcgggaggcggaggtgggcgcggagctccgcgctgcggcccccactccccgctgcgcctcggagcctcgggctgcccgctccgcgacgccgccgtcggttggtaccgtcgagctttcttgggctgcgccagccccgacaccagcgaccgggactcgccggagctgcccgaggacacggagcgggcgggcggcggcgggcgggcggcggcgcggggccccgcgggcgggaggcagagctccggaggccgcgaggaagaggaggaacgcggcgaggaagcgggcgaagcggagcagcgagccgccggccgcaagaagaagacgcgcacggtgttcagccgcagccaggtcttccagctggagtccaccttcgacgtgaagcgctacctgagcagctccgagagggccggcctggccgcctcgctgcacctcaccgagacgcaggtgaagatttggttccagaaccgccgcaacaagtggaagcggcagctcgccgccgacctggaggcggccaacctctcacacgccgcccaaaggattgtgcgggtccccattttgtaccacgagaactcgccggccagcgccttgggcttcggcctgccccacatgtccccccccttggtgggcttctccggcggcgtcagttaccccctgggcaccttccccgccgcctcccttcccttccttcgctcgcagatgacgggactcgtctgagcgcccacctgtgtcgggaccgcggccccgagccccctcccttggcttccagcttcaccctcggactttttctttccactttcaccattttccgcttttcgacttttatttaaaaaaaa
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]