GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2020-12-05 23:01:19, GGRNA.v2 : RefSeq release 202 (Sep, 2020)

LOCUS       NM_205015                894 bp    mRNA    linear   VRT 26-JUN-2020
DEFINITION  Gallus gallus T-cell leukemia homeobox 1 (TLX1), mRNA.
ACCESSION   NM_205015 XM_429269
VERSION     NM_205015.1
KEYWORDS    RefSeq.
SOURCE      Gallus gallus (chicken)
  ORGANISM  Gallus gallus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Archelosauria; Archosauria; Dinosauria; Saurischia; Theropoda;
            Coelurosauria; Aves; Neognathae; Galloanserae; Galliformes;
            Phasianidae; Phasianinae; Gallus.
REFERENCE   1  (bases 1 to 894)
  AUTHORS   Logan C, Wingate RJ, McKay IJ and Lumsden A.
  TITLE     Tlx-1 and Tlx-3 homeobox gene expression in cranial sensory ganglia
            and hindbrain of the chick embryo: markers of patterned
            connectivity
  JOURNAL   J. Neurosci. 18 (14), 5389-5402 (1998)
   PUBMED   9651221
COMMENT     PROVISIONAL REFSEQ: This record has not yet been subject to final
            NCBI review. The reference sequence was derived from AF071874.1.
            On Aug 30, 2004 this sequence version replaced XM_429269.1.
            
            ##Evidence-Data-START##
            Transcript exon combination :: AF071874.1 [ECO:0000332]
            ##Evidence-Data-END##
FEATURES             Location/Qualifiers
     source          1..894
                     /organism="Gallus gallus"
                     /mol_type="mRNA"
                     /db_xref="taxon:9031"
                     /chromosome="6"
                     /map="6"
                     /breed="Rhode Island Red"
     gene            1..894
                     /gene="TLX1"
                     /gene_synonym="TLX-1"
                     /note="T-cell leukemia homeobox 1"
                     /db_xref="CGNC:5922"
                     /db_xref="GeneID:395868"
     CDS             1..894
                     /gene="TLX1"
                     /gene_synonym="TLX-1"
                     /note="homeobox TLX-1; homeobox protein Hox-11"
                     /codon_start=1
                     /product="T-cell leukemia homeobox protein 1"
                     /protein_id="NP_990346.1"
                     /db_xref="CGNC:5922"
                     /db_xref="GeneID:395868"
                     /translation="
MEHLGAHHLHQGQAEPISFGIDQILNTSEPGSCMVSHPRLQDSADYGLGCIVGSAYNTVTGGYGASGGGAGAYGGTSCSMGALPGSYNVNMAVSMNGNALSSAGGVIRVPAHRPVAGGVHQPLSAAVPPVNGMNSLTGLTFPWMESNRRYTKDRFTGHPYQNRTPPKKKKPRTSFTRLQICELEKRFHRQKYLASAERAALAKALKMTDAQVKTWFQNRRTKWRRQTAEEREAERQQANRILMQLQQEAFQKTINQPIQADPICVHNSSLFALQNLQPWSDDSTKITSVTTVASACE"
     misc_feature    order(505..519,523..525,574..576,592..594,631..633,
                     637..642,649..654,658..666,670..675)
                     /gene="TLX1"
                     /gene_synonym="TLX-1"
                     /note="DNA binding site [nucleotide binding]"
                     /db_xref="CDD:238039"
     misc_feature    511..672
                     /gene="TLX1"
                     /gene_synonym="TLX-1"
                     /note="Homeobox domain; Region: Homeobox; pfam00046"
                     /db_xref="CDD:278475"
     misc_feature    order(511..513,520..522,640..642,649..654,661..663)
                     /gene="TLX1"
                     /gene_synonym="TLX-1"
                     /note="specific DNA base contacts [nucleotide binding];
                     other site"
                     /db_xref="CDD:238039"
     exon            1..469
                     /gene="TLX1"
                     /gene_synonym="TLX-1"
                     /inference="alignment:Splign:2.1.0"
     exon            470..671
                     /gene="TLX1"
                     /gene_synonym="TLX-1"
                     /inference="alignment:Splign:2.1.0"
     exon            672..894
                     /gene="TLX1"
                     /gene_synonym="TLX-1"
                     /inference="alignment:Splign:2.1.0"
ORIGIN      
atggagcacctcggggctcaccacctgcaccaaggccaagccgagcccatcagcttcggcatcgaccagatcctcaacacgtcggagccgggaagctgcatggtgtcccacccgcggctgcaggactcggcggattacggcctgggttgcatcgtgggcagcgcctacaacacggtcaccggcggctacggggcgagcggcggcggggccggagcctacggcggcacctcgtgcagtatgggagccttgcccggctcctacaacgtgaacatggcggtgagcatgaacggcaacgctttgagctcggccgggggggtgatccgcgtcccggcccaccgccccgtagccggcggcgtgcaccagcccctctccgccgccgtgccgccggtgaacggcatgaacagtctgacggggctcaccttcccctggatggagagcaacaggcggtacacaaaggacaggttcacaggtcacccctaccagaaccgcacgccccccaagaagaagaagccgcgcacgtccttcacccgcctgcagatctgtgagctggagaagcgcttccaccggcagaagtacctggcctctgctgagcgtgcagccctggccaaggccctcaagatgacggacgcccaggtgaagacgtggttccagaaccggcgcaccaagtggaggaggcagacagcggaggagcgggaggccgagaggcagcaagcgaaccgcatcctcatgcagctgcagcaggaggccttccaaaaaaccatcaaccagcccatccaggccgaccccatctgcgtgcacaactcctctctcttcgccctgcagaacctccagccctggtctgacgactccaccaagatcaccagcgtcaccaccgtcgcctcygcctgcgaataa
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]