LOCUS       NM_205012               1379 bp    mRNA    linear   VRT 24-SEP-2023
DEFINITION  Gallus gallus HESX homeobox 1 (HESX1), mRNA.
ACCESSION   NM_205012
VERSION     NM_205012.3
KEYWORDS    RefSeq.
SOURCE      Gallus gallus (chicken)
  ORGANISM  Gallus gallus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Archelosauria; Archosauria; Dinosauria; Saurischia; Theropoda;
            Coelurosauria; Aves; Neognathae; Galloanserae; Galliformes;
            Phasianidae; Phasianinae; Gallus.
REFERENCE   1  (bases 1 to 1379)
  AUTHORS   Tang H, Finn RD and Thomas PD.
  TITLE     TreeGrafter: phylogenetic tree-based annotation of proteins with
            Gene Ontology terms and other annotations
  JOURNAL   Bioinformatics 35 (3), 518-520 (2019)
   PUBMED   30032202
REFERENCE   2  (bases 1 to 1379)
  AUTHORS   Spieler D, Baumer N, Stebler J, Koprunner M, Reichman-Fried M,
            Teichmann U, Raz E, Kessel M and Wittler L.
  TITLE     Involvement of Pax6 and Otx2 in the forebrain-specific regulation
            of the vertebrate homeobox gene ANF/Hesx1
  JOURNAL   Dev Biol 269 (2), 567-579 (2004)
   PUBMED   15110720
REFERENCE   3  (bases 1 to 1379)
  AUTHORS   Peale FV Jr, Mason K, Hunter AW and Bothwell M.
  TITLE     Multiplex display polymerase chain reaction amplifies and resolves
            related sequences sharing a single moderately conserved domain
  JOURNAL   Anal Biochem 256 (2), 158-168 (1998)
   PUBMED   9473273
REFERENCE   4  (bases 1 to 1379)
  AUTHORS   Kazanskaya OV, Severtzova EA, Barth KA, Ermakova GV, Lukyanov SA,
            Benyumov AO, Pannese M, Boncinelli E, Wilson SW and Zaraisky AG.
  TITLE     Anf: a novel class of vertebrate homeobox genes expressed at the
            anterior end of the main embryonic axis
  JOURNAL   Gene 200 (1-2), 25-34 (1997)
   PUBMED   9373136
COMMENT     VALIDATED REFSEQ: This record has undergone validation or
            preliminary review. The reference sequence was derived from
            JAENSK010000252.1.
            
            On Dec 3, 2021 this sequence version replaced NM_205012.2.
            
            Sequence Note: The RefSeq transcript and protein were derived from
            genomic sequence to make the sequence consistent with the reference
            genome assembly. The genomic coordinates used for the transcript
            record were based on alignments.
            
            ##Evidence-Data-START##
            Transcript exon combination :: CR352461.1 [ECO:0000332]
            RNAseq introns              :: mixed sample support SAMEA103992290,
                                           SAMEA103992323 [ECO:0006172]
            ##Evidence-Data-END##
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-192               JAENSK010000252.1  5756715-5756906     c
            193-296             JAENSK010000252.1  5754753-5754856     c
            297-425             JAENSK010000252.1  5751623-5751751     c
            426-693             JAENSK010000252.1  5749712-5749979     c
            694-899             JAENSK010000252.1  5749388-5749593     c
            900-1001            JAENSK010000252.1  5749004-5749105     c
            1002-1379           JAENSK010000252.1  5747699-5748076     c
FEATURES             Location/Qualifiers
     source          1..1379
                     /organism="Gallus gallus"
                     /mol_type="mRNA"
                     /db_xref="taxon:9031"
                     /chromosome="12"
                     /map="12"
     gene            1..1379
                     /gene="HESX1"
                     /gene_synonym="GANF"
                     /note="HESX homeobox 1"
                     /db_xref="CGNC:4101"
                     /db_xref="GeneID:395864"
     exon            1..192
                     /gene="HESX1"
                     /gene_synonym="GANF"
                     /inference="alignment:Splign:2.1.0"
     exon            193..296
                     /gene="HESX1"
                     /gene_synonym="GANF"
                     /inference="alignment:Splign:2.1.0"
     exon            297..425
                     /gene="HESX1"
                     /gene_synonym="GANF"
                     /inference="alignment:Splign:2.1.0"
     exon            426..693
                     /gene="HESX1"
                     /gene_synonym="GANF"
                     /inference="alignment:Splign:2.1.0"
     misc_feature    429..431
                     /gene="HESX1"
                     /gene_synonym="GANF"
                     /note="upstream in-frame stop codon"
     CDS             468..1100
                     /gene="HESX1"
                     /gene_synonym="GANF"
                     /note="homeodomain-containing protein; anterior neural
                     fold protein; homeobox protein GANF; homeo box (expressed
                     in ES cells) 1; homeobox, ES cell expressed 1"
                     /codon_start=1
                     /product="homeobox protein ANF-1"
                     /protein_id="NP_990343.3"
                     /db_xref="CGNC:4101"
                     /db_xref="GeneID:395864"
                     /translation="

MCCAVLAEGETMASTSLCAANPSASQNLRKVSGFVENKTTQCSFSIESILGLEQKKDGIAAVKPHRPWMDVCTNLVLGDDSDPHLQIPVVSYENSLFHANSNLMQEEKVLNCEKYFSVTERLSFKRELSWYRGRRPRTAFTRNQIEVLENVFKMNSYPGIDIREELARKLDLEEDRIQIWFQNRRAKLKRSHRESQFLMVKNNFTSSLLE"

     misc_feature    order(867..881,885..887,936..938,954..956,993..995,
                     999..1004,1011..1016,1020..1028,1032..1037)
                     /gene="HESX1"
                     /gene_synonym="GANF"
                     /note="DNA binding site [nucleotide binding]"
                     /db_xref="CDD:238039"
     misc_feature    873..1034
                     /gene="HESX1"
                     /gene_synonym="GANF"
                     /note="Homeobox domain; Region: Homeobox; pfam00046"
                     /db_xref="CDD:425441"
     misc_feature    order(873..875,882..884,1002..1004,1011..1016,1023..1025)
                     /gene="HESX1"
                     /gene_synonym="GANF"
                     /note="specific DNA base contacts [nucleotide binding];
                     other site"
                     /db_xref="CDD:238039"
     exon            694..899
                     /gene="HESX1"
                     /gene_synonym="GANF"
                     /inference="alignment:Splign:2.1.0"
     exon            900..1001
                     /gene="HESX1"
                     /gene_synonym="GANF"
                     /inference="alignment:Splign:2.1.0"
     exon            1002..1379
                     /gene="HESX1"
                     /gene_synonym="GANF"
                     /inference="alignment:Splign:2.1.0"
ORIGIN      

ctgacgggaggtggtttgtggttcgggttgctttcgcgcgcgatgagcggcgggagctgcgcctcgcgcctcgcgcctcggagctggcgcttacctgcgcggcggagcgctgcgggactgccgccaccgcgtcctgtcagggtggggacgtccctcccgctcttggtgcgggagctcgttaggctgagccagggagaagagcagccaacggctcttttaaggatttcagatgtgtcccctaatggagagaactttggctctgctgaggagtggaattagctgactggatcaggtagttcatgggagtgtggatcatgcatatgaagacagccttactgagagatgagtcccgtgggccttgttactctttctcaatgctgacatgatcagaaggcatggcagtagccagtgagctgcttatacagctataaggaggacttctggagaaatgcaagtacagtgagtgtatgtgctgtgctgtgctggctgaaggtgaaaccatggcaagtacatcgctgtgtgcagctaatccatcagcatctcagaatcttcggaaagtgtctggttttgtagaaaataaaaccacacagtgctcattttccattgaaagtattttaggattggagcagaagaaggatggcattgcagctgtgaaacctcacagaccgtggatggatgtgtgcaccaacttggttttaggtgatgacagtgatccacatctgcaaatccctgttgtttcctatgaaaattcattatttcatgctaacagtaatctaatgcaagaggaaaaagttttgaactgtgaaaaatatttttcagtcactgaaaggttatctttcaaacgagaattgagctggtataggggtagaagaccgagaactgctttcactagaaaccagattgaagtcttggaaaatgtttttaaaatgaactcctaccctggcattgatattagagaagaattagctcgcaagttagatttagaggaagacaggatccagatctggttccagaaccgtcgtgcaaaactgaagagatcccaccgagaatcacagtttttaatggtgaaaaataatttcacctccagcctgctagagtaggaggaaggatggtttgccttgatgttactacaatgggacttgaagaattactggcattgttgtaatttgtattaaacaatgattatgtattaattatgattttatccctagatttgaaagattatcatttttcactcaaataaactgtaaatatgtgaagtattgtaaactaatttttgtggagaaagtgaacttttcctatatattttaataaatatgttcagaaaagtttaaatattttttgcagttaaaaaataaaccgtaagttctgggttgtgt

//