2024-10-23 02:05:55, GGRNA.v2 : RefSeq release 226 (Sep, 2024)
LOCUS NM_204708 2948 bp mRNA linear VRT 24-SEP-2023 DEFINITION Gallus gallus DEAD-box helicase 4 (DDX4), mRNA. ACCESSION NM_204708 VERSION NM_204708.3 KEYWORDS RefSeq. SOURCE Gallus gallus (chicken) ORGANISM Gallus gallus Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Archelosauria; Archosauria; Dinosauria; Saurischia; Theropoda; Coelurosauria; Aves; Neognathae; Galloanserae; Galliformes; Phasianidae; Phasianinae; Gallus. REFERENCE 1 (bases 1 to 2948) AUTHORS Lejong M, Choa-Duterre M, Vanmuylder N and Louryan S. TITLE Is Vasa such a highly specific marker for primordial germ cells? A comparison of VASA and HSP90 proteins expression in young chicken embryos JOURNAL Morphologie 104 (344), 20-26 (2020) PUBMED 32057659 REMARK GeneRIF: Is Vasa such a highly specific marker for primordial germ cells? A comparison of VASA and HSP90 proteins expression in young chicken embryos. REFERENCE 2 (bases 1 to 2948) AUTHORS Aduma N, Izumi H, Mizushima S and Kuroiwa A. TITLE Knockdown of DEAD-box helicase 4 (DDX4) decreases the number of germ cells in male and female chicken embryonic gonads JOURNAL Reprod Fertil Dev 31 (5), 847-854 (2019) PUBMED 30554591 REMARK GeneRIF: Male and female gonads of DDX4-knockdown embryos contained a decreased number of primordial germ cells, indicating that DDX4 is essential to maintain a normal level of these cells in chicken embryos of both sexes. REFERENCE 3 (bases 1 to 2948) AUTHORS Tang H, Finn RD and Thomas PD. TITLE TreeGrafter: phylogenetic tree-based annotation of proteins with Gene Ontology terms and other annotations JOURNAL Bioinformatics 35 (3), 518-520 (2019) PUBMED 30032202 REFERENCE 4 (bases 1 to 2948) AUTHORS Burge S, Kelly E, Lonsdale D, Mutowo-Muellenet P, McAnulla C, Mitchell A, Sangrador-Vegas A, Yong SY, Mulder N and Hunter S. TITLE Manual GO annotation of predictive protein signatures: the InterPro approach to GO curation JOURNAL Database (Oxford) 2012, bar068 (2012) PUBMED 22301074 REMARK Publication Status: Online-Only REFERENCE 5 (bases 1 to 2948) AUTHORS Kito G, Aramaki S, Tanaka K, Soh T, Yamauchi N and Hattori MA. TITLE Temporal and spatial differential expression of chicken germline-specific proteins cDAZL, CDH and CVH during gametogenesis JOURNAL J Reprod Dev 56 (3), 341-346 (2010) PUBMED 20332590 REMARK GeneRIF: cDAZL, CDH and CVH are expressed in chicken germ cells, but their patterns of expression are temporally and spatially distinct REFERENCE 6 (bases 1 to 2948) AUTHORS Lavial F, Acloque H, Bachelard E, Nieto MA, Samarut J and Pain B. TITLE Ectopic expression of Cvh (Chicken Vasa homologue) mediates the reprogramming of chicken embryonic stem cells to a germ cell fate JOURNAL Dev Biol 330 (1), 73-82 (2009) PUBMED 19324033 REMARK GeneRIF: Thus, our results demonstrate that Vasa can drive ES cell differentiation towards the germ cell lineage, both in vitro and in vivo REFERENCE 7 (bases 1 to 2948) AUTHORS Minematsu T, Harumi T and Naito M. TITLE Germ cell-specific expression of GFP gene induced by chicken vasa homologue (Cvh) promoter in early chicken embryos JOURNAL Mol Reprod Dev 75 (10), 1515-1522 (2008) PUBMED 18324671 REMARK GeneRIF: Cvh promoter provide the basis for for visualization, purification and genetical modification of germ cells, and might further contribute to our understanding of the development, proliferation, migration and differentiation of germ cells in the chicken REFERENCE 8 (bases 1 to 2948) AUTHORS Tsunekawa N, Naito M, Sakai Y, Nishida T and Noce T. TITLE Isolation of chicken vasa homolog gene and tracing the origin of primordial germ cells JOURNAL Development 127 (12), 2741-2750 (2000) PUBMED 10821771 COMMENT VALIDATED REFSEQ: This record has undergone validation or preliminary review. The reference sequence was derived from JAENSK010000089.1. On Nov 23, 2021 this sequence version replaced NM_204708.2. Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments. ##Evidence-Data-START## Transcript exon combination :: SRR13267659.94459.1, SRR13267654.10508.1 [ECO:0000332] RNAseq introns :: single sample supports all introns SAMEA103992290 [ECO:0000348] ##Evidence-Data-END## PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP 1-42 JAENSK010000089.1 4448155-4448196 43-143 JAENSK010000089.1 4448385-4448485 144-270 JAENSK010000089.1 4449861-4449987 271-339 JAENSK010000089.1 4452158-4452226 340-414 JAENSK010000089.1 4455227-4455301 415-501 JAENSK010000089.1 4456118-4456204 502-585 JAENSK010000089.1 4456828-4456911 586-627 JAENSK010000089.1 4458815-4458856 628-770 JAENSK010000089.1 4460052-4460194 771-923 JAENSK010000089.1 4460898-4461050 924-1078 JAENSK010000089.1 4467997-4468151 1079-1208 JAENSK010000089.1 4469265-4469394 1209-1375 JAENSK010000089.1 4470431-4470597 1376-1521 JAENSK010000089.1 4474545-4474690 1522-1621 JAENSK010000089.1 4475530-4475629 1622-1892 JAENSK010000089.1 4476511-4476781 1893-1973 JAENSK010000089.1 4476934-4477014 1974-2948 JAENSK010000089.1 4478969-4479943 FEATURES Location/Qualifiers source 1..2948 /organism="Gallus gallus" /mol_type="mRNA" /db_xref="taxon:9031" /chromosome="Z" /map="Z" gene 1..2948 /gene="DDX4" /note="DEAD-box helicase 4" /db_xref="CGNC:10908" /db_xref="GeneID:395447" exon 1..42 /gene="DDX4" /inference="alignment:Splign:2.1.0" exon 43..143 /gene="DDX4" /inference="alignment:Splign:2.1.0" CDS 63..2054 /gene="DDX4" /EC_number="3.6.4.13" /note="Cvh; DEAD (Asp-Glu-Ala-Asp) box polypeptide 4" /codon_start=1 /product="probable ATP-dependent RNA helicase DDX4" /protein_id="NP_990039.2" /db_xref="CGNC:10908" /db_xref="GeneID:395447" /translation="
MEEDWDTELEQEAAAASQGRSEEQAWMANSGRPNSPSLRFSSRPSSPLSGFPGRPNSPFFGFSQNKGSLGANEGLNRSLPVQHDIGGYSGSRESVVRPNREDQPVTRFGRGRSSGSRDFQERNSANDPGMQDQGFRRVPGIFGQSKCFNSEERNSPLRGSPFAPGGRGAVGGPAGVLKGRSEEIDSGRGPKVTYVPPPPPEDEQSIFACYQSGINFDKYDECAVEMSGLDPPAPLLAFEEANFAQTLRKNISKTGYSKLTPVQKHSIPVIQAGRDLMSCAQTGSGKTAAFLLPIVDRMMKDGVTASAFQKQQEPQCIIVAPTRELINQIFLEARKFVYGTCIRPVVIYGGTQTGHSIRQIMQGCNILCATPGRLLDIIEKGKISLVEVKYLVLDEADRMLDMGFGLDMKKLISYPEMPSKDRRQTLMFSATFPEEVQRLAGEFLKTDYIFLVIGNTCGACSDVQQNILQVPRLSKRDKLIEILQSTGGERTMVFVDTKKKADYLAAFLCQENLPSTSIHGDREQREREIALRDFRSGKCQILVATSVASRGLDIENVQHVINFDLPNTIEDYVHRIGRTGRCGNTGKAVSFFDDQSDGHLVQSLLKVLSEAQQEVPVWLEEMAVQRTNIVASLGAQRNNAGRGRMNPREMRMSYSETTFKSWE"
misc_feature 642..1433 /gene="DDX4" /note="DEAD-box helicase domain of DEAD box protein 4; Region: DEADc_DDX4; cd18052" /db_xref="CDD:350810" misc_feature order(708..710,738..740,774..776,828..830,834..842, 849..851,903..923,1242..1247,1350..1352) /gene="DDX4" /note="ATP binding site [chemical binding]; other site" /db_xref="CDD:350810" misc_feature order(1023..1031,1107..1112,1170..1181,1188..1190, 1254..1256,1272..1274) /gene="DDX4" /note="RNA binding site [nucleotide binding]; other site" /db_xref="CDD:350810" misc_feature 1449..1838 /gene="DDX4" /note="C-terminal helicase domain of the DEAD box helicases; Region: SF2_C_DEAD; cd18787" /db_xref="CDD:350174" misc_feature order(1713..1715,1719..1721,1794..1796,1803..1808) /gene="DDX4" /note="ATP binding site [chemical binding]; other site" /db_xref="CDD:350174" exon 144..270 /gene="DDX4" /inference="alignment:Splign:2.1.0" exon 271..339 /gene="DDX4" /inference="alignment:Splign:2.1.0" exon 340..414 /gene="DDX4" /inference="alignment:Splign:2.1.0" exon 415..501 /gene="DDX4" /inference="alignment:Splign:2.1.0" exon 502..585 /gene="DDX4" /inference="alignment:Splign:2.1.0" exon 586..627 /gene="DDX4" /inference="alignment:Splign:2.1.0" exon 628..770 /gene="DDX4" /inference="alignment:Splign:2.1.0" exon 771..923 /gene="DDX4" /inference="alignment:Splign:2.1.0" exon 924..1078 /gene="DDX4" /inference="alignment:Splign:2.1.0" exon 1079..1208 /gene="DDX4" /inference="alignment:Splign:2.1.0" exon 1209..1375 /gene="DDX4" /inference="alignment:Splign:2.1.0" exon 1376..1521 /gene="DDX4" /inference="alignment:Splign:2.1.0" exon 1522..1621 /gene="DDX4" /inference="alignment:Splign:2.1.0" exon 1622..1892 /gene="DDX4" /inference="alignment:Splign:2.1.0" exon 1893..1973 /gene="DDX4" /inference="alignment:Splign:2.1.0" exon 1974..2948 /gene="DDX4" /inference="alignment:Splign:2.1.0" ORIGIN
gctatttggagcggagagtgaaagttacagttcctggtgctggtgggctgctggcattcgctatggaggaggactgggacacggagctggagcaggaggcggcagcggcttcccaggggcgttctgaggagcaggcgtggatggctaactctggcagaccaaacagcccatccctccgcttctccagcagaccaagcagccccttgtctggcttcccaggcagaccaaacagccccttctttggctttagtcagaataaaggctcacttggtgctaatgaaggacttaacagaagtctgcctgtgcagcatgacattggaggatattctgggagcagagagtctgttgtacgtccaaacagagaagatcaaccagtgactagatttggtagagggaggagttctggaagcagagattttcaagagaggaactctgcaaatgatcctggtatgcaagatcaaggttttagaagagttcctggcatctttgggcaaagcaagtgttttaacagtgaggaaagaaatagtcctctgcgtggcagcccttttgccccaggaggaagaggagcagttggaggtcctgcaggagttctcaaaggacgctctgaagaaattgattctggaagaggtccaaaggtgacttatgtcccccctcctccacctgaagatgaacagtccatctttgcatgttatcagtcaggaattaattttgacaagtatgatgaatgtgctgttgagatgtcaggacttgaccctccagcaccattactggcttttgaagaagctaactttgctcagactttaaggaagaatatatctaaaactggatattcaaaacttactccagtgcagaagcacagcattcctgttatacaagcagggcgggatttaatgtcatgtgcccagacaggatcaggaaaaacagcagcttttcttctaccaattgtggaccggatgatgaaagatggtgtaactgcaagtgccttccaaaagcagcaagaaccacaatgcattattgttgcaccaactagagaactgataaatcagatcttcttagaagcaaggaagtttgtgtatgggacttgtataaggcctgttgtgatctatggaggtacacagacaggtcattcaatccgtcaaataatgcaaggctgtaatatattatgtgccactcctggaaggcttcttgacattattgaaaaagggaagatcagtttggtggaggtgaaatatttggtactagatgaagcagaccgcatgctcgatatgggttttggattagatatgaagaagctgatttcttatccagaaatgccatctaaagacagacgtcaaacattaatgtttagtgccacttttcctgaggaagttcaaaggctggctggtgaatttttgaaaacagactatatatttcttgttattggaaatacctgtggagcctgcagtgatgttcagcaaaatattcttcaggttccccggttatccaagagggataaactaatagaaattctacaaagcacaggtggtgaacgaaccatggtgtttgtggacacaaagaaaaaagcagattaccttgcagcctttctttgtcaagagaacctaccatccaccagcattcatggagatagggaacagagagagagagagatagctcttcgcgatttccgttctggaaaatgtcaaattcttgtggcaacttcggtagcatcaagaggcctggatattgaaaatgttcaacatgttattaattttgatctccctaacaccattgaagattatgtacatcgaattggacgaactggtcgttgtggaaatactggcaaagcagtttcattctttgatgatcagtcagatggccatcttgtacaatctctacttaaagtgctttcagaagcccagcaggaagttccggtttggttggaagaaatggctgtccaaagaacaaatattgttgcttcacttggtgcccaaaggaataatgcaggccgtggcagaatgaacccaagagaaatgaggatgtcatattctgaaacaacatttaagtcatgggagtaaagcaaatttagcactaaactctgttgtattctgttgtggtttaagtgaactgttgcagttaatgtttaattactgttaagttttatgaaatgctttgtgtttacaagctaccttgtatctcatgatggcgctttcaacaatgaaaaaggaacccatcgttgattctcactcagtgtaggaaggcaaaagccattttcaggaaaaaaaagcctgaaactaagtgttaaatgtttcagtcagtaggtgtttactgatgcttatatgttactacaaataatgtgttgctataaaagagtgagttgtcatccctgttttgcttgcaagtggaaaatagcatatcacttgaacttaatactttgttattaaaattcagttaaattgcaacttggaagcagtgtatgtattcagtgccctggacagcatgactccttttcttgacaattttccgcaggatttgtgtatccattatgacttcaggtcagaagcttggggtcatcttgatttgctagctgtaggaaatacgtatgagtagtaatttctggagggagatgtacacttgaagtcttccgtgtctatgaaaagcaaccagagtaactgcagtcatgggtcatctgtatcctaagaaaaagccttcgaagggggctgacttatccttgtttcgaggatcacttcaatcacagggtgctttttgctttgcctcctgtcttatacctgtttggttggggagtatcaggatgagttgtgtaactgactaaagaggtattctggatctgttgtaggcttgcattttatttgtagcttgtaaaataattcttatcatagttttcctacatttcgtacatttcattgcgttctgtacaattcatcaaataaagcatctcaaatgttttctac
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]