ver.2
Home
|
Help
|
Advanced search
Previous release (v1)
2026-08-13 22:15:06, GGRNA.v2 : RefSeq release 233 (Jan, 2026)
LOCUS NM_204202 1175 bp mRNA linear VRT 23-SEP-2023 DEFINITION Gallus gallus claudin 3 (CLDN3), mRNA. ACCESSION NM_204202 VERSION NM_204202.2 KEYWORDS RefSeq. SOURCE Gallus gallus (chicken) ORGANISM Gallus gallus Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Archelosauria; Archosauria; Dinosauria; Saurischia; Theropoda; Coelurosauria; Aves; Neognathae; Galloanserae; Galliformes; Phasianidae; Phasianinae; Gallus. REFERENCE 1 (bases 1 to 1175) AUTHORS Tang H, Finn RD and Thomas PD. TITLE TreeGrafter: phylogenetic tree-based annotation of proteins with Gene Ontology terms and other annotations JOURNAL Bioinformatics 35 (3), 518-520 (2019) PUBMED 30032202 REFERENCE 2 (bases 1 to 1175) AUTHORS Danzinger S, Tan YY, Rudas M, Kastner MT, Weingartshofer S, Muhr D and Singer CF. CONSRTM kConFab Investigators TITLE Differential Claudin 3 and EGFR Expression Predicts BRCA1 Mutation in Triple-Negative Breast Cancer JOURNAL Cancer Invest 36 (7), 378-388 (2018) PUBMED 30142017 REMARK GeneRIF: CLDN3 expression and negative EGFR expression are associated with BRCA1 mutations in triple-negative breast cancers. REFERENCE 3 (bases 1 to 1175) AUTHORS Burge S, Kelly E, Lonsdale D, Mutowo-Muellenet P, McAnulla C, Mitchell A, Sangrador-Vegas A, Yong SY, Mulder N and Hunter S. TITLE Manual GO annotation of predictive protein signatures: the InterPro approach to GO curation JOURNAL Database (Oxford) 2012, bar068 (2012) PUBMED 22301074 REMARK Publication Status: Online-Only REFERENCE 4 (bases 1 to 1175) AUTHORS Haddad N, El Andalousi J, Khairallah H, Yu M, Ryan AK and Gupta IR. TITLE The tight junction protein claudin-3 shows conserved expression in the nephric duct and ureteric bud and promotes tubulogenesis in vitro JOURNAL Am J Physiol Renal Physiol 301 (5), F1057-F1065 (2011) PUBMED 21775479 REMARK GeneRIF: Cldn3 may therefore promote tubule formation and expansion of the ureteric bud epithelium REFERENCE 5 (bases 1 to 1175) AUTHORS Haworth KE, El-Hanfy A, Prayag S, Healy C, Dietrich S and Sharpe P. TITLE Expression of Claudin-3 during chick development JOURNAL Gene Expr Patterns 6 (1), 40-44 (2005) PUBMED 16024293 REMARK GeneRIF: The early expression domains of Claudin 3 in the developing chick embryo include the mesoderm surrounding Hensen's node and the head fold. COMMENT VALIDATED REFSEQ: This record has undergone validation or preliminary review. The reference sequence was derived from JAENSK010000323.1. On Oct 18, 2021 this sequence version replaced NM_204202.1. ##Evidence-Data-START## Transcript is intronless :: AF334677.1, BM490185.1 [ECO:0000345] ##Evidence-Data-END## PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP 1-1175 JAENSK010000323.1 695137-696311 c FEATURES Location/Qualifiers source 1..1175 /organism="Gallus gallus" /mol_type="mRNA" /db_xref="taxon:9031" /chromosome="19" /map="19" gene 1..1175 /gene="CLDN3" /gene_synonym="claudin-3" /note="claudin 3" /db_xref="CGNC:49012" /db_xref="GeneID:374029" exon 1..1175 /gene="CLDN3" /gene_synonym="claudin-3" /inference="alignment:Splign:2.1.0" CDS 87..731 /gene="CLDN3" /gene_synonym="claudin-3" /codon_start=1 /product="claudin-3" /protein_id="NP_989533.1" /db_xref="CGNC:49012" /db_xref="GeneID:374029" /translation="
MSMGLEIGGVALSVLGWLCSIICCALPMWRVTAFIGNNIVTAQIIWEGLWMNCVVQSTGQMQCKVYDSMLALPQDLQAARALLVVAIVLAVLGLMVAIVGAQCTRCVEDETTKAKITIVSGVIFLLSGIMTLIPVSWSANTIIRDFYNPLVIDAQKRELGTSLYVGWAASALLLFGGALLCCSCPPKDERYAPSKVAYSAPRSAVTSYDKRNYV"
misc_feature 93..593
/gene="CLDN3"
/gene_synonym="claudin-3"
/note="PMP-22/EMP/MP20/Claudin family; Region:
PMP22_Claudin; cl21598"
/db_xref="CDD:473919"
ORIGIN
gatccccacggctgcagcagcgagcggagcacagggtggtttcggtcagcgggttcctctctgccatcgcccgggagccggacaccatgtctatggggctggagatcggtggggtggccctgtcggtgctgggctggctgtgcagcatcatctgctgcgcgctgcccatgtggagggtgacggccttcatcggcaacaacatcgtgacggcgcagatcatctgggaagggctgtggatgaactgcgtggtgcagagcacggggcagatgcagtgcaaggtgtacgactccatgctggccctgccgcaggacctgcaggccgcccgcgcgctgctggtggtggccatcgtgctggccgtgctgggcctgatggtggccatcgtgggcgcccagtgcacgcgctgcgtggaggacgagaccaccaaggccaagatcaccatcgtctccggcgtcatcttcctgctctccggcatcatgaccctcatccccgtctcctggtcggccaacaccatcatccgggatttctacaacccgctggtgatcgacgctcagaagcgggagctgggcacgtccctctacgtgggctgggcggcctccgcgctgctgctctttgggggggccctgctgtgctgctcctgcccccccaaagacgagaggtacgcgcccagcaaggtggcttactccgccccgcgctccgccgttaccagctacgacaagaggaactatgtgtgagccccccgcgccccccggcccagccctatggggggctcagccgcccccgcgcccacttccagccccaccgccgggaccgccaccgccggggaccctccgccccgcgggccggggagagagctcctgtccccgagggtgcccagcacggtgggagcaggcggggaaatgaagggggggcgatgggatcggtgccggggtcagggccgggcagtgtgagcgggagccgggcgggcggctgtgtcaatactgatggtttcatgtaaacagagccggtttcgggttgccaggagagctgtgtgcagcagcaccaggaggaagctccgtgccccccccgccctgccccgccggcccccccgggaccccccgccggccgggcaccttctctccctgttacgcgtggtctgtacaagttacatttgtcaataaaggaatcctgttttggta
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]