GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2019-03-25 14:48:17, GGRNA.v2 : RefSeq release 92 (Jan, 2019)

LOCUS       NM_130233               1474 bp    mRNA    linear   PLN 20-MAR-2017
DEFINITION  Arabidopsis thaliana homeobox 7 (HB-7), mRNA.
ACCESSION   NM_130233
VERSION     NM_130233.5
DBLINK      BioProject: PRJNA116
            BioSample: SAMN03081427
KEYWORDS    RefSeq.
SOURCE      Arabidopsis thaliana (thale cress)
  ORGANISM  Arabidopsis thaliana
            Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta;
            Spermatophyta; Magnoliophyta; eudicotyledons; Gunneridae;
            Pentapetalae; rosids; malvids; Brassicales; Brassicaceae;
            Camelineae; Arabidopsis.
REFERENCE   1  (bases 1 to 1474)
  AUTHORS   Lin,X., Kaul,S., Rounsley,S., Shea,T.P., Benito,M.I., Town,C.D.,
            Fujii,C.Y., Mason,T., Bowman,C.L., Barnstead,M., Feldblyum,T.V.,
            Buell,C.R., Ketchum,K.A., Lee,J., Ronning,C.M., Koo,H.L.,
            Moffat,K.S., Cronin,L.A., Shen,M., Pai,G., Van Aken,S., Umayam,L.,
            Tallon,L.J., Gill,J.E., Adams,M.D., Carrera,A.J., Creasy,T.H.,
            Goodman,H.M., Somerville,C.R., Copenhaver,G.P., Preuss,D.,
            Nierman,W.C., White,O., Eisen,J.A., Salzberg,S.L., Fraser,C.M. and
            Venter,J.C.
  TITLE     Sequence and analysis of chromosome 2 of the plant Arabidopsis
            thaliana
  JOURNAL   Nature 402 (6763), 761-768 (1999)
   PUBMED   10617197
REFERENCE   2  (bases 1 to 1474)
  CONSRTM   NCBI Genome Project
  TITLE     Direct Submission
  JOURNAL   Submitted (20-MAR-2017) National Center for Biotechnology
            Information, NIH, Bethesda, MD 20894, USA
REFERENCE   3  (bases 1 to 1474)
  AUTHORS   Krishnakumar,V., Cheng,C.-Y., Chan,A.P., Schobel,S., Kim,M.,
            Ferlanti,E.S., Belyaeva,I., Rosen,B.D., Micklem,G., Miller,J.R.,
            Vaughn,M. and Town,C.D.
  TITLE     Direct Submission
  JOURNAL   Submitted (17-MAY-2016) Plant Genomics, J. Craig Venter Institute,
            9704 Medical Center Dr, Rockville, MD 20850, USA
  REMARK    Protein update by submitter
REFERENCE   4  (bases 1 to 1474)
  AUTHORS   Swarbreck,D., Lamesch,P., Wilks,C. and Huala,E.
  CONSRTM   TAIR
  TITLE     Direct Submission
  JOURNAL   Submitted (18-FEB-2011) Department of Plant Biology, Carnegie
            Institution, 260 Panama Street, Stanford, CA, USA
COMMENT     REVIEWED REFSEQ: This record has been curated by TAIR and Araport.
            This record is derived from an annotated genomic sequence
            (NC_003071).
            On Sep 12, 2016 this sequence version replaced NM_130233.4.
FEATURES             Location/Qualifiers
     source          1..1474
                     /organism="Arabidopsis thaliana"
                     /mol_type="mRNA"
                     /db_xref="taxon:3702"
                     /chromosome="2"
                     /ecotype="Columbia"
     gene            1..1474
                     /gene="HB-7"
                     /locus_tag="AT2G46680"
                     /gene_synonym="ARABIDOPSIS THALIANA HOMEOBOX 7; ATHB-7;
                     ATHB7; homeobox 7; T3A4.6"
                     /note="encodes a putative transcription factor that
                     contains a homeodomain closely linked to a leucine zipper
                     motif. Transcript is detected in all tissues examined. Is
                     transcriptionally regulated in an ABA-dependent manner and
                     may act in a signal transduction pathway which mediates a
                     drought response."
                     /db_xref="Araport:AT2G46680"
                     /db_xref="GeneID:819280"
                     /db_xref="TAIR:AT2G46680"
     CDS             195..971
                     /gene="HB-7"
                     /locus_tag="AT2G46680"
                     /gene_synonym="ARABIDOPSIS THALIANA HOMEOBOX 7; ATHB-7;
                     ATHB7; homeobox 7; T3A4.6"
                     /inference="Similar to RNA sequence,
                     EST:INSD:BP854758.1,INSD:DR233712.1,INSD:DR233709.1,
                     INSD:AV806472.1,INSD:BP647224.1,INSD:BP800276.1,
                     INSD:ES208668.1,INSD:EL336118.1,INSD:BP813873.1,
                     INSD:BP792285.1,INSD:DR233719.1,INSD:DR750868.1,
                     INSD:AV795324.1,INSD:DR233714.1,INSD:AV794937.1,
                     INSD:BP571005.1,INSD:DR233716.1,INSD:AV793818.1,
                     INSD:DR233718.1,INSD:BP819614.1,INSD:ES138475.1,
                     INSD:CB255622.1,INSD:ES115159.1,INSD:DR233713.1,
                     INSD:EG509958.1,INSD:BP560756.1,INSD:DR233711.1,
                     INSD:BP630359.1,INSD:EH845849.1,INSD:EG463062.1,
                     INSD:DR233715.1,INSD:DR233720.1,INSD:AV807256.1,
                     INSD:ES176832.1,INSD:DR233710.1,INSD:ES180175.1,
                     INSD:DR233717.1,INSD:AV809855.1,INSD:DR750794.1,
                     INSD:BP562589.2,INSD:DR750795.1,INSD:AV798924.1,
                     INSD:ES083022.1,INSD:AV802260.1,INSD:DR233721.1,
                     INSD:CB256263.1,INSD:BP622548.1,INSD:BP866643.1,
                     INSD:ES155022.1,INSD:EG509938.1,INSD:ES170298.1,
                     INSD:CB258800.1,INSD:ES188544.1,INSD:BP822188.1,
                     INSD:CD532852.1,INSD:CB255984.1,INSD:EG463061.1,
                     INSD:AV823530.1,INSD:BP573767.1,INSD:AV810667.1,
                     INSD:CD531397.1,INSD:BP568652.1,INSD:AV803693.1,
                     INSD:CD534816.1,INSD:CF652646.1,INSD:EL205159.1,
                     INSD:AV818837.1,INSD:AV782933.1,INSD:AV797136.1,
                     INSD:BP814465.1,INSD:AV805989.1"
                     /inference="similar to RNA sequence,
                     mRNA:INSD:BX820975.1,INSD:X67032.1,INSD:AY045826.1,
                     INSD:BX819893.1,INSD:BX820417.1,INSD:AY091364.1"
                     /note="homeobox 7 (HB-7); FUNCTIONS IN: transcription
                     activator activity, sequence-specific DNA binding
                     transcription factor activity; INVOLVED IN: response to
                     water deprivation, abscisic acid mediated signaling
                     pathway, regulation of transcription, DNA-dependent,
                     response to abscisic acid stimulus; LOCATED IN: nucleus;
                     EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 6
                     growth stages; CONTAINS InterPro DOMAIN/s: Homeobox,
                     conserved site (InterPro:IPR017970), Homeobox
                     (InterPro:IPR001356), Homeodomain-like
                     (InterPro:IPR009057), Helix-turn-helix motif, lambda-like
                     repressor (InterPro:IPR000047), Leucine zipper,
                     homeobox-associated (InterPro:IPR003106),
                     Homeodomain-related (InterPro:IPR012287); BEST Arabidopsis
                     thaliana protein match is: homeobox 12 (TAIR:AT3G61890.1);
                     Has 11865 Blast hits to 11755 proteins in 611 species:
                     Archae - 0; Bacteria - 26; Metazoa - 9035; Fungi - 216;
                     Plants - 2052; Viruses - 14; Other Eukaryotes - 522
                     (source: NCBI BLink)."
                     /codon_start=1
                     /product="homeobox 7"
                     /protein_id="NP_182191.1"
                     /db_xref="Araport:AT2G46680"
                     /db_xref="GeneID:819280"
                     /db_xref="TAIR:AT2G46680"
                     /translation="
MTEGGEYSPAMMSAEPFLTMKKMKKSNHNKNNQRRFSDEQIKSLEMMFESETRLEPRKKVQLARELGLQPRQVAIWFQNKRARWKSKQLETEYNILRQNYDNLASQFESLKKEKQALVSELQRLKEATQKKTQEEERQCSGDQAVVALSSTHHESENEENRRRKPEEVRPEMEMKDDKGHHGVMCDHHDYEDDDNGYSNNIKREYFGGFEEEPDHLMNIVEPADSCLTSSDDWRGFKSDTTTLLDQSSNNYPWRDFWS"
     misc_feature    order(282..296,300..302,351..353,369..371,408..410,
                     414..419,426..431,435..443,447..452)
                     /gene="HB-7"
                     /locus_tag="AT2G46680"
                     /gene_synonym="ARABIDOPSIS THALIANA HOMEOBOX 7; ATHB-7;
                     ATHB7; homeobox 7; T3A4.6"
                     /note="DNA binding site [nucleotide binding]"
                     /db_xref="CDD:238039"
     misc_feature    order(288..290,297..299,417..419,426..431,438..440)
                     /gene="HB-7"
                     /locus_tag="AT2G46680"
                     /gene_synonym="ARABIDOPSIS THALIANA HOMEOBOX 7; ATHB-7;
                     ATHB7; homeobox 7; T3A4.6"
                     /note="specific DNA base contacts [nucleotide binding];
                     other site"
                     /db_xref="CDD:238039"
     misc_feature    297..449
                     /gene="HB-7"
                     /locus_tag="AT2G46680"
                     /gene_synonym="ARABIDOPSIS THALIANA HOMEOBOX 7; ATHB-7;
                     ATHB7; homeobox 7; T3A4.6"
                     /note="Homeobox domain; Region: Homeobox; pfam00046"
                     /db_xref="CDD:278475"
     misc_feature    453..572
                     /gene="HB-7"
                     /locus_tag="AT2G46680"
                     /gene_synonym="ARABIDOPSIS THALIANA HOMEOBOX 7; ATHB-7;
                     ATHB7; homeobox 7; T3A4.6"
                     /note="Homeobox associated leucine zipper; Region: HALZ;
                     pfam02183"
                     /db_xref="CDD:280364"
ORIGIN      
aaagttatatcttattatatgctaaggagccctcccaaaaaagaacaacaaatcacatttttatataactgttaacataataatctcagcctcatcaacacacatatatagatagccaacatcacacaaacatagagattccaaaaaataaaaataaagaaaacataaatcctctgaggaaaaattccgatgagatgacagaaggtggagaatattctccggcgatgatgtcagcagagccattcttgaccatgaagaagatgaagaagagcaaccacaacaagaacaatcagagaaggtttagcgacgagcagatcaagtcactggagatgatgtttgagtctgagacaaggcttgagccaaggaagaaggttcaattagctagagagctagggttgcagccgaggcaagtggctatatggtttcagaacaagagggctcgttggaaatccaagcagctcgagactgagtacaacattctcagacaaaactacgacaacttggcttctcagttcgagtccttaaagaaagaaaaacaagctttagtctctgagttgcagaggctaaaagaggcgacgcaaaagaagacacaggaggaggaaaggcagtgtagtggagatcaagcggtggttgctctaagcagcacacatcatgaatcagaaaacgaagagaaccggaggcgtaaaccggaagaggttagaccggagatggagatgaaagatgataagggtcatcatggggttatgtgtgatcatcatgattatgaagatgatgataatggttatagtaacaacatcaagagagagtattttggtgggtttgaggaagaaccagatcacttaatgaacattgttgaaccagctgatagttgtttgacatcatctgatgattggagaggtttcaaatcagatactactactctcttggaccaatccagcaacaattacccttggcgggatttttggtcatgaaaacaataaactctaaacaagaagatgaaacagattgagactaaagattggatatatacatattcaaatcgaaatttaccggtctacatcgcatgaaccgagccacggatatagagatattcggtccagcaaatgactcgtttctcagcgagaattttgcaggattttgagctgaaattgtatggttttgtctgtataaatgatgtgtttagaaagacgtatattctcagttcgtgtttgtaattctgtttttaagtagtaagtactcgtcatgctttgtagctaagtagtaagtttaagactaaatttggatgaataaaaatcaaaagcaggagaaatcatatatataaagtgttatgcattaatatgtaaaagatcaagaagagaactaagttggtgagaagaaactgatattaggaacacgaaaagaaccatgaaacccaagttaacatcttcttgactcggaagatttaaggagaaactttgtttttttctcaacaaaa
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]