GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2019-03-23 03:29:27, GGRNA.v2 : RefSeq release 92 (Jan, 2019)

LOCUS       NM_128948               1620 bp    mRNA    linear   PLN 20-MAR-2017
DEFINITION  Arabidopsis thaliana homeobox-3 (HB-3), mRNA.
ACCESSION   NM_128948
VERSION     NM_128948.4
DBLINK      BioProject: PRJNA116
            BioSample: SAMN03081427
KEYWORDS    RefSeq.
SOURCE      Arabidopsis thaliana (thale cress)
  ORGANISM  Arabidopsis thaliana
            Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta;
            Spermatophyta; Magnoliophyta; eudicotyledons; Gunneridae;
            Pentapetalae; rosids; malvids; Brassicales; Brassicaceae;
            Camelineae; Arabidopsis.
REFERENCE   1  (bases 1 to 1620)
  AUTHORS   Lin,X., Kaul,S., Rounsley,S., Shea,T.P., Benito,M.I., Town,C.D.,
            Fujii,C.Y., Mason,T., Bowman,C.L., Barnstead,M., Feldblyum,T.V.,
            Buell,C.R., Ketchum,K.A., Lee,J., Ronning,C.M., Koo,H.L.,
            Moffat,K.S., Cronin,L.A., Shen,M., Pai,G., Van Aken,S., Umayam,L.,
            Tallon,L.J., Gill,J.E., Adams,M.D., Carrera,A.J., Creasy,T.H.,
            Goodman,H.M., Somerville,C.R., Copenhaver,G.P., Preuss,D.,
            Nierman,W.C., White,O., Eisen,J.A., Salzberg,S.L., Fraser,C.M. and
            Venter,J.C.
  TITLE     Sequence and analysis of chromosome 2 of the plant Arabidopsis
            thaliana
  JOURNAL   Nature 402 (6763), 761-768 (1999)
   PUBMED   10617197
REFERENCE   2  (bases 1 to 1620)
  CONSRTM   NCBI Genome Project
  TITLE     Direct Submission
  JOURNAL   Submitted (20-MAR-2017) National Center for Biotechnology
            Information, NIH, Bethesda, MD 20894, USA
REFERENCE   3  (bases 1 to 1620)
  AUTHORS   Krishnakumar,V., Cheng,C.-Y., Chan,A.P., Schobel,S., Kim,M.,
            Ferlanti,E.S., Belyaeva,I., Rosen,B.D., Micklem,G., Miller,J.R.,
            Vaughn,M. and Town,C.D.
  TITLE     Direct Submission
  JOURNAL   Submitted (17-MAY-2016) Plant Genomics, J. Craig Venter Institute,
            9704 Medical Center Dr, Rockville, MD 20850, USA
  REMARK    Protein update by submitter
REFERENCE   4  (bases 1 to 1620)
  AUTHORS   Swarbreck,D., Lamesch,P., Wilks,C. and Huala,E.
  CONSRTM   TAIR
  TITLE     Direct Submission
  JOURNAL   Submitted (18-FEB-2011) Department of Plant Biology, Carnegie
            Institution, 260 Panama Street, Stanford, CA, USA
COMMENT     REVIEWED REFSEQ: This record has been curated by TAIR and Araport.
            This record is derived from an annotated genomic sequence
            (NC_003071).
            On Sep 12, 2016 this sequence version replaced NM_128948.3.
FEATURES             Location/Qualifiers
     source          1..1620
                     /organism="Arabidopsis thaliana"
                     /mol_type="mRNA"
                     /db_xref="taxon:3702"
                     /chromosome="2"
                     /ecotype="Columbia"
     gene            1..1620
                     /gene="HB-3"
                     /locus_tag="AT2G33880"
                     /gene_synonym="homeobox-3; STIMPY; STIP; T1B8.31; T1B8_31;
                     WOX9; WOX9A; WUSCHEL related homeobox 9A; WUSCHEL-RELATED
                     HOMEOBOX 9"
                     /note="Encodes a protein with similarity to WUS type
                     homeodomain protein. Required for meristem growth and
                     development and acts through positive regulation of WUS.
                     Loss of function phenotypes include embryo lethality,
                     hyponastic cotyledons, reduced root development and
                     smaller meristems. Phenotypes can be rescued by addition
                     of sucrose in the growth media. Overexpression can
                     partially rescue the triple mutant cytokinin receptor
                     phenotype suggesting HB-3 is a downstream effector of
                     cytokinin signaling."
                     /db_xref="Araport:AT2G33880"
                     /db_xref="GeneID:817958"
                     /db_xref="TAIR:AT2G33880"
     CDS             200..1336
                     /gene="HB-3"
                     /locus_tag="AT2G33880"
                     /gene_synonym="homeobox-3; STIMPY; STIP; T1B8.31; T1B8_31;
                     WOX9; WOX9A; WUSCHEL related homeobox 9A; WUSCHEL-RELATED
                     HOMEOBOX 9"
                     /inference="Similar to RNA sequence,
                     EST:INSD:EG423239.1,INSD:AV537767.1,INSD:EG423238.1,
                     INSD:AU239368.1,INSD:AV530532.1,INSD:AV549782.1,
                     INSD:EG423251.1,INSD:EG423246.1,INSD:EG423245.1,
                     INSD:BP824090.1,INSD:EG423244.1,INSD:AU230666.1,
                     INSD:EG423253.1,INSD:EG423247.1,INSD:DR749859.1,
                     INSD:EG419637.1,INSD:EG423248.1,INSD:EL325055.1,
                     INSD:EH825006.1,INSD:EG423240.1,INSD:EG423243.1,
                     INSD:EG423242.1,INSD:EG419636.1,INSD:DR749858.1"
                     /inference="similar to RNA sequence,
                     mRNA:INSD:AY251401.1,INSD:AK118501.1"
                     /note="homeobox-3 (HB-3); CONTAINS InterPro DOMAIN/s:
                     Homeobox (InterPro:IPR001356), Homeodomain-like
                     (InterPro:IPR009057); BEST Arabidopsis thaliana protein
                     match is: WUSCHEL related homeobox 8 (TAIR:AT5G45980.1);
                     Has 671 Blast hits to 615 proteins in 76 species: Archae -
                     0; Bacteria - 0; Metazoa - 25; Fungi - 22; Plants - 589;
                     Viruses - 0; Other Eukaryotes - 35 (source: NCBI BLink)."
                     /codon_start=1
                     /product="homeobox-3"
                     /protein_id="NP_180944.2"
                     /db_xref="Araport:AT2G33880"
                     /db_xref="GeneID:817958"
                     /db_xref="TAIR:AT2G33880"
                     /translation="
MASSNRHWPSMFKSKPHPHQWQHDINSPLLPSASHRSSPFSSGCEVERSPEPKPRWNPKPEQIRILEAIFNSGMVNPPREEIRRIRAQLQEYGQVGDANVFYWFQNRKSRSKHKLRLLHNHSKHSLPQTQPQPQPQPSASSSSSSSSSSSKSTKPRKSKNKNNTNLSLGGSQMMGMFPPEPAFLFPVSTVGGFEGITVSSQLGFLSGDMIEQQKPAPTCTGLLLSEIMNGSVSYGTHHQQHLSEKEVEEMRMKMLQQPQTQICYATTNHQIASYNNNNNNNNIMLHIPPTTSTATTITTSHSLATVPSTSDQLQVQADARIRVFINEMELEVSSGPFNVRDAFGEEVVLINSAGQPIVTDEYGVALHPLQHGASYYLI"
     misc_feature    order(353..367,371..373,425..427,443..445,494..496,
                     500..505,512..517,521..529,533..538)
                     /gene="HB-3"
                     /locus_tag="AT2G33880"
                     /gene_synonym="homeobox-3; STIMPY; STIP; T1B8.31; T1B8_31;
                     WOX9; WOX9A; WUSCHEL related homeobox 9A; WUSCHEL-RELATED
                     HOMEOBOX 9"
                     /note="DNA binding site [nucleotide binding]"
                     /db_xref="CDD:238039"
     misc_feature    359..541
                     /gene="HB-3"
                     /locus_tag="AT2G33880"
                     /gene_synonym="homeobox-3; STIMPY; STIP; T1B8.31; T1B8_31;
                     WOX9; WOX9A; WUSCHEL related homeobox 9A; WUSCHEL-RELATED
                     HOMEOBOX 9"
                     /note="Homeobox domain; Region: Homeobox; pfam00046"
                     /db_xref="CDD:278475"
     misc_feature    order(359..361,368..370,503..505,512..517,524..526)
                     /gene="HB-3"
                     /locus_tag="AT2G33880"
                     /gene_synonym="homeobox-3; STIMPY; STIP; T1B8.31; T1B8_31;
                     WOX9; WOX9A; WUSCHEL related homeobox 9A; WUSCHEL-RELATED
                     HOMEOBOX 9"
                     /note="specific DNA base contacts [nucleotide binding];
                     other site"
                     /db_xref="CDD:238039"
ORIGIN      
ctataagagggagagaaagaggtcgtaacccttttgccctattcacatttttatttatctttccatttagccattctgttccctgtctcttcctcctctctttttgacacatcacatcatcatcacatcatcattcaacatcaatcatcatcatatgcatacacatacatctgtgttctgcggatcgagttaattagttatggcttcttcgaatagacactggccaagcatgttcaagtccaaacctcatccccatcaatggcaacatgacatcaactctcctctcttgccttctgcttctcaccgatcttctcctttctcttcaggatgtgaagtggagaggagtccagagccaaaaccaagatggaatccaaagccagagcagattcggatacttgaagcaatctttaactccgggatggtgaatcctccaagagaggagatcaggaggattagggctcagcttcaagaatacggccaagtcggtgatgctaacgtcttctactggttccaaaaccgtaagtcccgtagtaaacacaaactccgcctcctccacaaccactccaaacactctctccctcaaacgcaaccgcagccgcagccgcaaccttcggcttcctcttcctcttcctcctcctcttcctcctccaaatccaccaaaccccgaaaaagcaagaacaagaacaacactaatctctctttgggtggtagtcaaatgatggggatgtttccaccggaaccggcgtttctcttcccggtctccactgtcggagggtttgaaggtatcaccgtctcatcccaattagggtttctctccggtgatatgattgagcaacaaaaaccggctccaacgtgtaccggactcctgctgagtgagatcatgaacggtagtgtgagttatggaactcatcatcaacaacacttgagtgagaaagaagttgaagaaatgaggatgaagatgttgcaacagccacagactcagatttgttacgctaccactaatcatcaaatagcttcttacaacaacaacaacaacaacaataacatcatgcttcatattcctcccactacttctactgccaccactattactacttcgcattctctcgctactgtcccatcaacttcggaccagcttcaagttcaagcggacgcacgaataagagttttcatcaatgaaatggagcttgaagtgagctcaggaccgttcaatgtgagggatgcatttggggaagaggttgttctgattaattccgcgggtcagcccattgtcaccgatgaatatggcgtcgctcttcaccctcttcaacacggagcctcgtactatctgatctagtcgtgtgggagatttgagtttgaagaagaaattaagacctgtctctttctttcaccatctctcgtacgtaggcttaaatgttaagattttataaagtattggtttcagttacctgttgtgacggtgtttatgtatgagtttcggacaacattcacaaaactctctcgttaaattgttgaccaataatatatgatgtgtgtttcattattatctaaagaaatctataatgttgttctgtttcttcttcttgaaaaattgattatatatgtggaattgttaaacaa
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]