2025-07-19 08:50:25, GGRNA.v2 : RefSeq release 229 (Mar, 2025)
LOCUS NM_120754 1639 bp mRNA linear PLN 20-OCT-2022 DEFINITION Arabidopsis thaliana homeobox leucine zipper protein (HAT14), mRNA. ACCESSION NM_120754 VERSION NM_120754.5 DBLINK BioProject: PRJNA116 BioSample: SAMN03081427 KEYWORDS RefSeq. SOURCE Arabidopsis thaliana (thale cress) ORGANISM Arabidopsis thaliana Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta; Spermatophyta; Magnoliopsida; eudicotyledons; Gunneridae; Pentapetalae; rosids; malvids; Brassicales; Brassicaceae; Camelineae; Arabidopsis. REFERENCE 1 (bases 1 to 1639) AUTHORS Tabata,S., Kaneko,T., Nakamura,Y., Kotani,H., Kato,T., Asamizu,E., Miyajima,N., Sasamoto,S., Kimura,T., Hosouchi,T., Kawashima,K., Kohara,M., Matsumoto,M., Matsuno,A., Muraki,A., Nakayama,S., Nakazaki,N., Naruo,K., Okumura,S., Shinpo,S., Takeuchi,C., Wada,T., Watanabe,A., Yamada,M., Yasuda,M., Sato,S., de la Bastide,M., Huang,E., Spiegel,L., Gnoj,L., O'Shaughnessy,A., Preston,R., Habermann,K., Murray,J., Johnson,D., Rohlfing,T., Nelson,J., Stoneking,T., Pepin,K., Spieth,J., Sekhon,M., Armstrong,J., Becker,M., Belter,E., Cordum,H., Cordes,M., Courtney,L., Courtney,W., Dante,M., Du,H., Edwards,J., Fryman,J., Haakensen,B., Lamar,E., Latreille,P., Leonard,S., Meyer,R., Mulvaney,E., Ozersky,P., Riley,A., Strowmatt,C., Wagner-McPherson,C., Wollam,A., Yoakum,M., Bell,M., Dedhia,N., Parnell,L., Shah,R., Rodriguez,M., See,L.H., Vil,D., Baker,J., Kirchoff,K., Toth,K., King,L., Bahret,A., Miller,B., Marra,M., Martienssen,R., McCombie,W.R., Wilson,R.K., Murphy,G., Bancroft,I., Volckaert,G., Wambutt,R., Dusterhoft,A., Stiekema,W., Pohl,T., Entian,K.D., Terryn,N., Hartley,N., Bent,E., Johnson,S., Langham,S.A., McCullagh,B., Robben,J., Grymonprez,B., Zimmermann,W., Ramsperger,U., Wedler,H., Balke,K., Wedler,E., Peters,S., van Staveren,M., Dirkse,W., Mooijman,P., Lankhorst,R.K., Weitzenegger,T., Bothe,G., Rose,M., Hauf,J., Berneiser,S., Hempel,S., Feldpausch,M., Lamberth,S., Villarroel,R., Gielen,J., Ardiles,W., Bents,O., Lemcke,K., Kolesov,G., Mayer,K., Rudd,S., Schoof,H., Schueller,C., Zaccaria,P., Mewes,H.W., Bevan,M. and Fransz,P. CONSRTM Kazusa DNA Research Institute; Cold Spring Harbor and Washington University in St Louis Sequencing Consortium; European Union Arabidopsis Genome Sequencing Consortium TITLE Sequence and analysis of chromosome 5 of the plant Arabidopsis thaliana JOURNAL Nature 408 (6814), 823-826 (2000) PUBMED 11130714 REFERENCE 2 (bases 1 to 1639) CONSRTM NCBI Genome Project TITLE Direct Submission JOURNAL Submitted (19-OCT-2022) National Center for Biotechnology Information, NIH, Bethesda, MD 20894, USA REFERENCE 3 (bases 1 to 1639) AUTHORS Krishnakumar,V., Cheng,C.-Y., Chan,A.P., Schobel,S., Kim,M., Ferlanti,E.S., Belyaeva,I., Rosen,B.D., Micklem,G., Miller,J.R., Vaughn,M. and Town,C.D. TITLE Direct Submission JOURNAL Submitted (17-MAY-2016) Plant Genomics, J. Craig Venter Institute, 9704 Medical Center Dr, Rockville, MD 20850, USA REMARK Protein update by submitter REFERENCE 4 (bases 1 to 1639) AUTHORS Swarbreck,D., Lamesch,P., Wilks,C. and Huala,E. CONSRTM TAIR TITLE Direct Submission JOURNAL Submitted (18-FEB-2011) Department of Plant Biology, Carnegie Institution, 260 Panama Street, Stanford, CA, USA COMMENT REVIEWED REFSEQ: This record has been curated by TAIR and Araport. This record is derived from an annotated genomic sequence (NC_003076). On Sep 12, 2016 this sequence version replaced NM_120754.4. FEATURES Location/Qualifiers source 1..1639 /organism="Arabidopsis thaliana" /mol_type="mRNA" /db_xref="taxon:3702" /chromosome="5" /ecotype="Columbia" gene 1..1639 /gene="HAT14" /locus_tag="AT5G06710" /gene_synonym="homeobox from Arabidopsis thaliana; MPH15.6; MPH15_6" /note="Homeobox-leucine zipper protein." /db_xref="Araport:AT5G06710" /db_xref="GeneID:830560" /db_xref="TAIR:AT5G06710" CDS 283..1293 /gene="HAT14" /locus_tag="AT5G06710" /gene_synonym="homeobox from Arabidopsis thaliana; MPH15.6; MPH15_6" /inference="Similar to RNA sequence, EST:INSD:BP570035.1,INSD:DR297346.1,INSD:BP566875.1, INSD:DR297347.1,INSD:DR751693.1,INSD:DR297345.1, INSD:BP568822.1,INSD:BP643286.1,INSD:AU235388.1, INSD:AU226069.1,INSD:DR380480.1,INSD:DR751694.1, INSD:BP566857.1,INSD:BP582658.1" /inference="similar to RNA sequence, mRNA:INSD:AK227423.1,INSD:U09334.1,INSD:BT005879.1, INSD:BX831576.1,INSD:AJ431182.1" /note="homeobox from Arabidopsis thaliana (HAT14); FUNCTIONS IN: DNA binding, sequence-specific DNA binding transcription factor activity; INVOLVED IN: regulation of transcription, DNA-dependent, regulation of transcription; LOCATED IN: nucleus; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: Homeobox, conserved site (InterPro:IPR017970), Homeobox (InterPro:IPR001356), Homeodomain-like (InterPro:IPR009057), Leucine zipper, homeobox-associated (InterPro:IPR003106), Homeodomain-related (InterPro:IPR012287); BEST Arabidopsis thaliana protein match is: Homeobox-leucine zipper protein family (TAIR:AT4G37790.1); Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink)." /codon_start=1 /product="homeobox leucine zipper protein" /protein_id="NP_196289.2" /db_xref="GeneID:830560" /db_xref="TAIR:AT5G06710" /db_xref="Araport:AT5G06710" /translation="
MELALSLGDNTKKQFSFMEKNSKINNPSVSSTSTSEKDLGFCMALDVAFGGHRSLSSSSSPSVEDEKKKPAPRAKKSDEFRVSSSVDPPLQLQLHFPNWLPENSKGRQGGRMPLGAATVVEEEEEEEEAVPSMSVSPPDSVTSSFQLDFGIKSYGYERRSNKRDIDDEVERSASRASNEDNDDENGSTRKKLRLSKDQSAFLEDSFKEHSTLNPKQKIALAKQLNLRPRQVEVWFQNRRARTKLKQTEVDCEYLKRCCESLTEENRRLQKEVKELRTLKTSTPFYMQLPATTLTMCPSCERVATSAAQPSTSAAHNLCLSTSSLIPVKPRPAKQVS"
misc_feature 841..1011 /gene="HAT14" /locus_tag="AT5G06710" /gene_synonym="homeobox from Arabidopsis thaliana; MPH15.6; MPH15_6" /note="Homeodomain; Region: HOX; smart00389" /db_xref="CDD:197696" misc_feature order(847..858,862..864,913..915,931..933,970..972, 976..981,988..993,997..1005,1009..1014) /gene="HAT14" /locus_tag="AT5G06710" /gene_synonym="homeobox from Arabidopsis thaliana; MPH15.6; MPH15_6" /note="DNA binding site [nucleotide binding]" /db_xref="CDD:238039" misc_feature order(850..852,859..861,979..981,988..993,1000..1002) /gene="HAT14" /locus_tag="AT5G06710" /gene_synonym="homeobox from Arabidopsis thaliana; MPH15.6; MPH15_6" /note="specific DNA base contacts [nucleotide binding]; other site" /db_xref="CDD:238039" misc_feature 1015..1146 /gene="HAT14" /locus_tag="AT5G06710" /gene_synonym="homeobox from Arabidopsis thaliana; MPH15.6; MPH15_6" /note="homeobox associated leucin zipper; Region: HALZ; smart00340" /db_xref="CDD:128634" ORIGIN
cattgttcacatatattaaaaaatatataattacataaatacatgccctattcatataccactaaaaagaatgatgacttaaatcacatgtcttaaggaatttataggatgaagatccaatatttgttcatatacataaataatattatttaaatacattgaacataggaaataaataagtggggtttcactttcatgtcaccactccataaggccacaacagatcttcttgttcctctctctcaatctctctctctaaaactcttattttcttcgtaagagatggaactagcgttgtctctaggcgacaatactaagaaacagttctcttttatggagaagaactcgaagattaataatccctctgtctcgtcgacatctacttccgagaaggatcttgggttctgcatggctttagatgttgcttttggtggtcacagatcgttgtcatcctcttcgtctccgtcggtagaggatgagaagaagaaaccggcgcccagagcaaaaaaatctgacgaatttagggtttcgtcttctgtagatccaccattacagcttcagcttcacttccctaattggctccctgagaacagtaaaggtcgacaaggaggaagaatgcccttaggagcagctacggttgtggaggaggaagaggaggaggaggaagcggtgcctagtatgtcagtatcgccgccggatagtgtaacgtcgtcgtttcaattggactttgggattaaaagttatggttatgagagaagaagcaataagagagatattgatgatgaagtggagagatcagcttcaagagccagcaacgaagacaacgatgacgagaatggatccactaggaagaaacttagactctccaaagaccaatctgcttttcttgaagacagcttcaaagaacacagtacccttaatcctaaacagaagattgcattggcgaagcagttgaatcttcgtcctcgtcaggttgaagtctggtttcaaaacagacgagccaggacaaagctgaagcaaacggaagtggactgtgaatacctaaagagatgctgtgagtcactaaccgaagaaaaccggaggcttcaaaaagaggttaaagaattgagaaccttgaagacttccacacccttttacatgcaacttccggccactactctcactatgtgcccttcttgtgaacgtgttgccacttcagcagcacagccctccacgtcagctgcccacaacctctgtttgtccacgtcatcattgattccggttaagcctcggccggccaaacaagtttcatgaaagcacctgcgaaatacagtttgagcaaacggtcgagctagagtggttttaaaagttgtcttcttgtgtatatatttattttacttttcatattttattagagaccgctattttgaaagacgaatagattgattatccggttagtgttttgtttttcttagataggaccggataaaaaacagatggagcaaaagggttgacatgttttattgaatgatagaggaatatagaagaagacaaaaggaaaaggggaaaatatttggtttgatcttatagacttttatttgtgattaaagcaaaagggtttgtcgtgcaaaaaatcttcactagatacgtttaattatcg
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]