GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2019-03-23 03:29:15, GGRNA.v2 : RefSeq release 92 (Jan, 2019)

LOCUS       NM_116054               1054 bp    mRNA    linear   PLN 20-MAR-2017
DEFINITION  Arabidopsis thaliana homeobox 12 (HB-12), mRNA.
ACCESSION   NM_116054
VERSION     NM_116054.3
DBLINK      BioProject: PRJNA116
            BioSample: SAMN03081427
KEYWORDS    RefSeq.
SOURCE      Arabidopsis thaliana (thale cress)
  ORGANISM  Arabidopsis thaliana
            Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta;
            Spermatophyta; Magnoliophyta; eudicotyledons; Gunneridae;
            Pentapetalae; rosids; malvids; Brassicales; Brassicaceae;
            Camelineae; Arabidopsis.
REFERENCE   1  (bases 1 to 1054)
  AUTHORS   Salanoubat,M., Lemcke,K., Rieger,M., Ansorge,W., Unseld,M.,
            Fartmann,B., Valle,G., Blocker,H., Perez-Alonso,M., Obermaier,B.,
            Delseny,M., Boutry,M., Grivell,L.A., Mache,R., Puigdomenech,P., De
            Simone,V., Choisne,N., Artiguenave,F., Robert,C., Brottier,P.,
            Wincker,P., Cattolico,L., Weissenbach,J., Saurin,W., Quetier,F.,
            Schafer,M., Muller-Auer,S., Gabel,C., Fuchs,M., Benes,V.,
            Wurmbach,E., Drzonek,H., Erfle,H., Jordan,N., Bangert,S.,
            Wiedelmann,R., Kranz,H., Voss,H., Holland,R., Brandt,P.,
            Nyakatura,G., Vezzi,A., D'Angelo,M., Pallavicini,A., Toppo,S.,
            Simionati,B., Conrad,A., Hornischer,K., Kauer,G., Lohnert,T.H.,
            Nordsiek,G., Reichelt,J., Scharfe,M., Schon,O., Bargues,M.,
            Terol,J., Climent,J., Navarro,P., Collado,C., Perez-Perez,A.,
            Ottenwalder,B., Duchemin,D., Cooke,R., Laudie,M., Berger-Llauro,C.,
            Purnelle,B., Masuy,D., de Haan,M., Maarse,A.C., Alcaraz,J.P.,
            Cottet,A., Casacuberta,E., Monfort,A., Argiriou,A., flores,M.,
            Liguori,R., Vitale,D., Mannhaupt,G., Haase,D., Schoof,H., Rudd,S.,
            Zaccaria,P., Mewes,H.W., Mayer,K.F., Kaul,S., Town,C.D., Koo,H.L.,
            Tallon,L.J., Jenkins,J., Rooney,T., Rizzo,M., Walts,A.,
            Utterback,T., Fujii,C.Y., Shea,T.P., Creasy,T.H., Haas,B.,
            Maiti,R., Wu,D., Peterson,J., Van Aken,S., Pai,G., Militscher,J.,
            Sellers,P., Gill,J.E., Feldblyum,T.V., Preuss,D., Lin,X.,
            Nierman,W.C., Salzberg,S.L., White,O., Venter,J.C., Fraser,C.M.,
            Kaneko,T., Nakamura,Y., Sato,S., Kato,T., Asamizu,E., Sasamoto,S.,
            Kimura,T., Idesawa,K., Kawashima,K., Kishida,Y., Kiyokawa,C.,
            Kohara,M., Matsumoto,M., Matsuno,A., Muraki,A., Nakayama,S.,
            Nakazaki,N., Shinpo,S., Takeuchi,C., Wada,T., Watanabe,A.,
            Yamada,M., Yasuda,M. and Tabata,S.
  CONSRTM   European Union Chromosome 3 Arabidopsis Sequencing Consortium;
            Institute for Genomic Research; Kazusa DNA Research Institute
  TITLE     Sequence and analysis of chromosome 3 of the plant Arabidopsis
            thaliana
  JOURNAL   Nature 408 (6814), 820-822 (2000)
   PUBMED   11130713
REFERENCE   2  (bases 1 to 1054)
  CONSRTM   NCBI Genome Project
  TITLE     Direct Submission
  JOURNAL   Submitted (20-MAR-2017) National Center for Biotechnology
            Information, NIH, Bethesda, MD 20894, USA
REFERENCE   3  (bases 1 to 1054)
  AUTHORS   Krishnakumar,V., Cheng,C.-Y., Chan,A.P., Schobel,S., Kim,M.,
            Ferlanti,E.S., Belyaeva,I., Rosen,B.D., Micklem,G., Miller,J.R.,
            Vaughn,M. and Town,C.D.
  TITLE     Direct Submission
  JOURNAL   Submitted (17-MAY-2016) Plant Genomics, J. Craig Venter Institute,
            9704 Medical Center Dr, Rockville, MD 20850, USA
  REMARK    Protein update by submitter
REFERENCE   4  (bases 1 to 1054)
  AUTHORS   Swarbreck,D., Lamesch,P., Wilks,C. and Huala,E.
  CONSRTM   TAIR
  TITLE     Direct Submission
  JOURNAL   Submitted (18-FEB-2011) Department of Plant Biology, Carnegie
            Institution, 260 Panama Street, Stanford, CA, USA
COMMENT     REVIEWED REFSEQ: This record has been curated by TAIR and Araport.
            This record is derived from an annotated genomic sequence
            (NC_003074).
            On Sep 12, 2016 this sequence version replaced NM_116054.2.
FEATURES             Location/Qualifiers
     source          1..1054
                     /organism="Arabidopsis thaliana"
                     /mol_type="mRNA"
                     /db_xref="taxon:3702"
                     /chromosome="3"
                     /ecotype="Columbia"
     gene            1..1054
                     /gene="HB-12"
                     /locus_tag="AT3G61890"
                     /gene_synonym="ARABIDOPSIS THALIANA HOMEOBOX 12; ATHB-12;
                     ATHB12; homeobox 12"
                     /note="Encodes a homeodomain leucine zipper class I
                     (HD-Zip I) protein. Loss of function mutant has abnormally
                     shaped leaves and stems."
                     /db_xref="Araport:AT3G61890"
                     /db_xref="GeneID:825362"
                     /db_xref="TAIR:AT3G61890"
     CDS             155..862
                     /gene="HB-12"
                     /locus_tag="AT3G61890"
                     /gene_synonym="ARABIDOPSIS THALIANA HOMEOBOX 12; ATHB-12;
                     ATHB12; homeobox 12"
                     /inference="Similar to RNA sequence,
                     EST:INSD:EH975339.1,INSD:DR749945.1,INSD:DR750521.1,
                     INSD:DR750571.1,INSD:DR750522.1,INSD:DR749825.1,
                     INSD:EH865316.1,INSD:AV818968.1,INSD:AV813021.1,
                     INSD:AI994027.1,INSD:EL002706.1,INSD:CB255936.1,
                     INSD:R30223.1,INSD:EG514989.1,INSD:DR374977.1,
                     INSD:AV832050.1,INSD:EL038577.1,INSD:BP787679.1,
                     INSD:AV815391.1,INSD:DR308461.1,INSD:BP780775.1,
                     INSD:EL208471.1,INSD:N97195.1,INSD:CK120370.1,
                     INSD:BP651716.1,INSD:DR750530.1,INSD:ES119517.1,
                     INSD:BP806760.1,INSD:N38387.1,INSD:AI099582.1,
                     INSD:AV813889.1,INSD:EL310306.1,INSD:ES012968.1,
                     INSD:EG514990.1,INSD:EL268916.1,INSD:AV785734.1"
                     /inference="Similar to RNA sequence,
                     mRNA:INSD:AY059828.1,INSD:AY087187.1,INSD:BT002206.1,
                     INSD:AF001949.1"
                     /note="homeobox 12 (HB-12); CONTAINS InterPro DOMAIN/s:
                     Homeobox, conserved site (InterPro:IPR017970), Homeobox
                     (InterPro:IPR001356), Homeodomain-like
                     (InterPro:IPR009057), Helix-turn-helix motif, lambda-like
                     repressor (InterPro:IPR000047), Leucine zipper,
                     homeobox-associated (InterPro:IPR003106),
                     Homeodomain-related (InterPro:IPR012287); BEST Arabidopsis
                     thaliana protein match is: homeobox 7 (TAIR:AT2G46680.1);
                     Has 10279 Blast hits to 10246 proteins in 542 species:
                     Archae - 1; Bacteria - 17; Metazoa - 7845; Fungi - 173;
                     Plants - 2032; Viruses - 4; Other Eukaryotes - 207
                     (source: NCBI BLink)."
                     /codon_start=1
                     /product="homeobox 12"
                     /protein_id="NP_191748.1"
                     /db_xref="GeneID:825362"
                     /db_xref="TAIR:AT3G61890"
                     /db_xref="Araport:AT3G61890"
                     /translation="
MEEGDFFNCCFSEISSGMTMNKKKMKKSNNQKRFSEEQIKSLELIFESETRLEPRKKVQVARELGLQPRQVAIWFQNKRARWKTKQLEKEYNTLRANYNNLASQFEIMKKEKQSLVSELQRLNEEMQRPKEEKHHECCGDQGLALSSSTESHNGKSEPEGRLDQGSVLCNDGDYNNNIKTEYFGFEEETDHELMNIVEKADDSCLTSSENWGGFNSDSLLDQSSSNYPNWWEFWS"
     misc_feature    251..403
                     /gene="HB-12"
                     /locus_tag="AT3G61890"
                     /gene_synonym="ARABIDOPSIS THALIANA HOMEOBOX 12; ATHB-12;
                     ATHB12; homeobox 12"
                     /note="Homeobox domain; Region: Homeobox; pfam00046"
                     /db_xref="CDD:278475"
     misc_feature    order(251..253,371..373,380..385,392..394)
                     /gene="HB-12"
                     /locus_tag="AT3G61890"
                     /gene_synonym="ARABIDOPSIS THALIANA HOMEOBOX 12; ATHB-12;
                     ATHB12; homeobox 12"
                     /note="specific DNA base contacts [nucleotide binding];
                     other site"
                     /db_xref="CDD:238039"
     misc_feature    407..532
                     /gene="HB-12"
                     /locus_tag="AT3G61890"
                     /gene_synonym="ARABIDOPSIS THALIANA HOMEOBOX 12; ATHB-12;
                     ATHB12; homeobox 12"
                     /note="Homeobox associated leucine zipper; Region: HALZ;
                     pfam02183"
                     /db_xref="CDD:280364"
ORIGIN      
ctacacaagcacacatagtaactcccacattatatataagcggccaatatcagcaactcagagattccagaaagaaagaaaaaaaagaaacaaataattccaaaaccttctctcttaatcaaaatcaagaaacttacaagatctggtgaaaaccatggaagaaggagattttttcaactgctgtttcagcgagattagtagtggcatgaccatgaataagaagaagatgaagaagagcaataaccaaaagaggtttagcgaggaacagatcaagtcacttgagcttatatttgagtctgagacgaggcttgagccgaggaagaaggttcaggtagctagagagctagggctgcaaccaagacaagtggctatatggtttcaaaacaagagggctcgatggaaaactaagcaacttgagaaagagtataacactcttagagccaattacaacaatttggcttcacaatttgaaatcatgaagaaagaaaagcaatctctggtctctgagctgcagagactaaacgaagagatgcaaaggcctaaagaagaaaagcatcatgagtgttgtggtgatcaaggactggctctaagcagcagcacagagtcgcataatggaaagagtgagccagaagggaggttagaccaagggagtgttctatgtaatgatggtgattacaacaacaacattaaaacagagtattttgggttcgaggaagagactgatcatgagctgatgaacattgtggagaaagctgatgatagttgcttgacatcttctgagaattggggaggtttcaattctgattctctcttagaccaatctagcagcaattaccctaactggtgggagttttggtcataaaagcatataagaaaaaaacagaacataagcgaagagaaagagtgtgaatagtttgtaaattatgtgttaagaaaaataaatttagtttagtttaaatcttgtttcgatctatgtatctactatgttcaatactctttgtagctaattagtagcttataatgagactagaaaagttttgaagtcaccaaggtt
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]