GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2019-03-23 03:26:33, GGRNA.v2 : RefSeq release 92 (Jan, 2019)

LOCUS       NM_111961               1052 bp    mRNA    linear   PLN 20-MAR-2017
DEFINITION  Arabidopsis thaliana WUSCHEL related homeobox 5 (WOX5), mRNA.
ACCESSION   NM_111961
VERSION     NM_111961.4
DBLINK      BioProject: PRJNA116
            BioSample: SAMN03081427
KEYWORDS    RefSeq.
SOURCE      Arabidopsis thaliana (thale cress)
  ORGANISM  Arabidopsis thaliana
            Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta;
            Spermatophyta; Magnoliophyta; eudicotyledons; Gunneridae;
            Pentapetalae; rosids; malvids; Brassicales; Brassicaceae;
            Camelineae; Arabidopsis.
REFERENCE   1  (bases 1 to 1052)
  AUTHORS   Salanoubat,M., Lemcke,K., Rieger,M., Ansorge,W., Unseld,M.,
            Fartmann,B., Valle,G., Blocker,H., Perez-Alonso,M., Obermaier,B.,
            Delseny,M., Boutry,M., Grivell,L.A., Mache,R., Puigdomenech,P., De
            Simone,V., Choisne,N., Artiguenave,F., Robert,C., Brottier,P.,
            Wincker,P., Cattolico,L., Weissenbach,J., Saurin,W., Quetier,F.,
            Schafer,M., Muller-Auer,S., Gabel,C., Fuchs,M., Benes,V.,
            Wurmbach,E., Drzonek,H., Erfle,H., Jordan,N., Bangert,S.,
            Wiedelmann,R., Kranz,H., Voss,H., Holland,R., Brandt,P.,
            Nyakatura,G., Vezzi,A., D'Angelo,M., Pallavicini,A., Toppo,S.,
            Simionati,B., Conrad,A., Hornischer,K., Kauer,G., Lohnert,T.H.,
            Nordsiek,G., Reichelt,J., Scharfe,M., Schon,O., Bargues,M.,
            Terol,J., Climent,J., Navarro,P., Collado,C., Perez-Perez,A.,
            Ottenwalder,B., Duchemin,D., Cooke,R., Laudie,M., Berger-Llauro,C.,
            Purnelle,B., Masuy,D., de Haan,M., Maarse,A.C., Alcaraz,J.P.,
            Cottet,A., Casacuberta,E., Monfort,A., Argiriou,A., flores,M.,
            Liguori,R., Vitale,D., Mannhaupt,G., Haase,D., Schoof,H., Rudd,S.,
            Zaccaria,P., Mewes,H.W., Mayer,K.F., Kaul,S., Town,C.D., Koo,H.L.,
            Tallon,L.J., Jenkins,J., Rooney,T., Rizzo,M., Walts,A.,
            Utterback,T., Fujii,C.Y., Shea,T.P., Creasy,T.H., Haas,B.,
            Maiti,R., Wu,D., Peterson,J., Van Aken,S., Pai,G., Militscher,J.,
            Sellers,P., Gill,J.E., Feldblyum,T.V., Preuss,D., Lin,X.,
            Nierman,W.C., Salzberg,S.L., White,O., Venter,J.C., Fraser,C.M.,
            Kaneko,T., Nakamura,Y., Sato,S., Kato,T., Asamizu,E., Sasamoto,S.,
            Kimura,T., Idesawa,K., Kawashima,K., Kishida,Y., Kiyokawa,C.,
            Kohara,M., Matsumoto,M., Matsuno,A., Muraki,A., Nakayama,S.,
            Nakazaki,N., Shinpo,S., Takeuchi,C., Wada,T., Watanabe,A.,
            Yamada,M., Yasuda,M. and Tabata,S.
  CONSRTM   European Union Chromosome 3 Arabidopsis Sequencing Consortium;
            Institute for Genomic Research; Kazusa DNA Research Institute
  TITLE     Sequence and analysis of chromosome 3 of the plant Arabidopsis
            thaliana
  JOURNAL   Nature 408 (6814), 820-822 (2000)
   PUBMED   11130713
REFERENCE   2  (bases 1 to 1052)
  CONSRTM   NCBI Genome Project
  TITLE     Direct Submission
  JOURNAL   Submitted (20-MAR-2017) National Center for Biotechnology
            Information, NIH, Bethesda, MD 20894, USA
REFERENCE   3  (bases 1 to 1052)
  AUTHORS   Krishnakumar,V., Cheng,C.-Y., Chan,A.P., Schobel,S., Kim,M.,
            Ferlanti,E.S., Belyaeva,I., Rosen,B.D., Micklem,G., Miller,J.R.,
            Vaughn,M. and Town,C.D.
  TITLE     Direct Submission
  JOURNAL   Submitted (17-MAY-2016) Plant Genomics, J. Craig Venter Institute,
            9704 Medical Center Dr, Rockville, MD 20850, USA
  REMARK    Protein update by submitter
REFERENCE   4  (bases 1 to 1052)
  AUTHORS   Swarbreck,D., Lamesch,P., Wilks,C. and Huala,E.
  CONSRTM   TAIR
  TITLE     Direct Submission
  JOURNAL   Submitted (18-FEB-2011) Department of Plant Biology, Carnegie
            Institution, 260 Panama Street, Stanford, CA, USA
COMMENT     REVIEWED REFSEQ: This record has been curated by TAIR and Araport.
            This record is derived from an annotated genomic sequence
            (NC_003074).
            On Sep 12, 2016 this sequence version replaced NM_111961.3.
FEATURES             Location/Qualifiers
     source          1..1052
                     /organism="Arabidopsis thaliana"
                     /mol_type="mRNA"
                     /db_xref="taxon:3702"
                     /chromosome="3"
                     /ecotype="Columbia"
     gene            1..1052
                     /gene="WOX5"
                     /locus_tag="AT3G11260"
                     /gene_synonym="WOX5B; WUSCHEL related homeobox 5; WUSCHEL
                     related homeobox 5B"
                     /note="Arabidopsis thaliana WOX5 protein mRNA"
                     /db_xref="Araport:AT3G11260"
                     /db_xref="GeneID:820297"
                     /db_xref="TAIR:AT3G11260"
     CDS             327..875
                     /gene="WOX5"
                     /locus_tag="AT3G11260"
                     /gene_synonym="WOX5B; WUSCHEL related homeobox 5; WUSCHEL
                     related homeobox 5B"
                     /inference="Similar to RNA sequence,
                     EST:INSD:DR750862.1,INSD:DR751206.1,INSD:DR750861.1,
                     INSD:EH977836.1"
                     /inference="Similar to RNA sequence,
                     mRNA:INSD:AY150812.1,INSD:AY251398.1"
                     /note="WUSCHEL related homeobox 5 (WOX5); CONTAINS
                     InterPro DOMAIN/s: Homeobox (InterPro:IPR001356),
                     Homeodomain-like (InterPro:IPR009057); BEST Arabidopsis
                     thaliana protein match is: WUSCHEL related homeobox 7
                     (TAIR:AT5G05770.1); Has 538 Blast hits to 538 proteins in
                     47 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi -
                     0; Plants - 538; Viruses - 0; Other Eukaryotes - 0
                     (source: NCBI BLink)."
                     /codon_start=1
                     /product="WUSCHEL related homeobox 5"
                     /protein_id="NP_187735.2"
                     /db_xref="GeneID:820297"
                     /db_xref="TAIR:AT3G11260"
                     /db_xref="Araport:AT3G11260"
                     /translation="
MSFSVKGRSLRGNNNGGTGTKCGRWNPTVEQLKILTDLFRAGLRTPTTDQIQKISTELSFYGKIESKNVFYWFQNHKARERQKRRKISIDFDHHHHQPSTRDVFEISEEDCQEEEKVIETLQLFPVNSFEDSNSKVDKMRARGNNQYREYIRETTTTSFSPYSSCGAEMEHPPPLDLRLSFL"
     misc_feature    order(396..401,405..407,459..461,477..479,528..530,
                     534..539,546..551,555..563,567..572)
                     /gene="WOX5"
                     /locus_tag="AT3G11260"
                     /gene_synonym="WOX5B; WUSCHEL related homeobox 5; WUSCHEL
                     related homeobox 5B"
                     /note="DNA binding site [nucleotide binding]"
                     /db_xref="CDD:238039"
     misc_feature    396..569
                     /gene="WOX5"
                     /locus_tag="AT3G11260"
                     /gene_synonym="WOX5B; WUSCHEL related homeobox 5; WUSCHEL
                     related homeobox 5B"
                     /note="Homeobox domain; Region: Homeobox; pfam00046"
                     /db_xref="CDD:278475"
     misc_feature    order(402..404,537..539,546..551,558..560)
                     /gene="WOX5"
                     /locus_tag="AT3G11260"
                     /gene_synonym="WOX5B; WUSCHEL related homeobox 5; WUSCHEL
                     related homeobox 5B"
                     /note="specific DNA base contacts [nucleotide binding];
                     other site"
                     /db_xref="CDD:238039"
ORIGIN      
atactaatatatacacacaaaaacatatgtaaatatagatggaacagaagcctagataggttaggataaagaaaacgatcaaatctgcaaagatcagtctctcccaaatccccaaaaaaaacaaagcatgcatttcgtaataaacaactcatcataaaacgacacataactcgaaaacctctcctcccgacatttcatcaattcatttctctttttattttcgaaaagatgaaaacttaataaattattatgaacaatcttactatatatatggatatatacacaggccctaaaacgtaaaacagttgaggactttacatctgaacatgtctttctccgtgaaaggtcgaagcttacgtggcaacaataacggaggaacggggacgaagtgcgggagatggaatccaacggtggagcagttgaagatattgactgatctgtttcgagccggtcttagaactccaacaactgatcagattcagaagatctctacggagctcagtttctacggcaagatagagagcaagaatgttttctattggtttcagaatcataaggctagggagaggcagaaacgtcgtaaaatctccattgattttgatcatcatcatcatcaaccatcaactagagatgtttttgaaataagcgaagaagattgtcaagaggaagagaaggtgatagagacattacaactctttccggtgaattcatttgaagactccaactccaaggtggacaaaatgagagctagaggcaataaccagtaccgtgaatatattcgagagaccaccacgacgtcgttttctccatactcatcatgtggagctgaaatggaacatccaccgccattagatcttcgattaagctttctttaagtcattgaccacaataacaaaagaaaaaaaacagatgctttagcctttaaaatgttgttgtattttgaattatgacatattatccgatgcatggtttatgagatattttccaatgcatggtttatcaaaaagttgtctcattttgtttgatataagaatctatgttatggaatgcgt
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]