ver.2
Home
|
Help
|
Advanced search
Previous release (v1)
2026-07-15 07:57:54, GGRNA.v2 : RefSeq release 233 (Jan, 2026)
LOCUS NM_053241 1173 bp mRNA linear ROD 20-JUN-2025 DEFINITION Mus musculus claudin 16 (Cldn16), mRNA. ACCESSION NM_053241 VERSION NM_053241.5 KEYWORDS RefSeq; RefSeq Select. SOURCE Mus musculus (house mouse) ORGANISM Mus musculus Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha; Muroidea; Muridae; Murinae; Mus; Mus. REFERENCE 1 (bases 1 to 1173) AUTHORS Adams,D.J., Barlas,B., McIntyre,R.E., Salguero,I., van der Weyden,L., Barros,A., Vicente,J.R., Karimpour,N., Haider,A., Ranzani,M., Turner,G., Thompson,N.A., Harle,V., Olvera-Leon,R., Robles-Espinoza,C.D., Speak,A.O., Geisler,N., Weninger,W.J., Geyer,S.H., Hewinson,J., Karp,N.A., Fu,B., Yang,F., Kozik,Z., Choudhary,J., Yu,L., van Ruiten,M.S., Rowland,B.D., Lelliott,C.J., Del Castillo Velasco-Herrera,M., Verstraten,R., Bruckner,L., Henssen,A.G., Rooimans,M.A., de Lange,J., Mohun,T.J., Arends,M.J., Kentistou,K.A., Coelho,P.A., Zhao,Y., Zecchini,H., Perry,J.R.B., Jackson,S.P. and Balmus,G. CONSRTM Sanger Mouse Genetics Project TITLE Genetic determinants of micronucleus formation in vivo JOURNAL Nature 627 (8002), 130-136 (2024) PUBMED 38355793 REFERENCE 2 (bases 1 to 1173) AUTHORS Al-Shebel,A., Michel,G., Breiderhoff,T. and Muller,D. TITLE Urinary Acidification Does Not Explain the Absence of Nephrocalcinosis in a Mouse Model of Familial Hypomagnesaemia with Hypercalciuria and Nephrocalcinosis (FHHNC) JOURNAL Int J Mol Sci 25 (3), 1779 (2024) PUBMED 38339056 REMARK Publication Status: Online-Only REFERENCE 3 (bases 1 to 1173) AUTHORS Paes,M.F., Zipinotti Dos Santos,D., Massariol Pimenta,T., Ribeiro Junior,R.S., da Silva Martins,B., Greco,S.J., Carvalho,A.A., Bacchi,C., Duarte,C., Carvalho,I., Silva,I.V. and Azevedo Rangel,L.B. TITLE Overexpression of CLDN16 in ovarian cancer is modulated by PI3K and PKC pathways JOURNAL Exp Cell Res 426 (2), 113523 (2023) PUBMED 36889572 REMARK GeneRIF: Overexpression of CLDN16 in ovarian cancer is modulated by PI3K and PKC pathways. REFERENCE 4 (bases 1 to 1173) AUTHORS Higashi,A.Y., Higashi,T., Furuse,K., Ozeki,K., Furuse,M. and Chiba,H. TITLE Claudin-9 constitutes tight junctions of folliculo-stellate cells in the anterior pituitary gland JOURNAL Sci Rep 11 (1), 21642 (2021) PUBMED 34737342 REMARK Publication Status: Online-Only REFERENCE 5 (bases 1 to 1173) AUTHORS Ingham,N.J., Pearson,S.A., Vancollie,V.E., Rook,V., Lewis,M.A., Chen,J., Buniello,A., Martelletti,E., Preite,L., Lam,C.C., Weiss,F.D., Powis,Z., Suwannarat,P., Lelliott,C.J., Dawson,S.J., White,J.K. and Steel,K.P. TITLE Mouse screen reveals multiple new genes underlying mouse and human hearing loss JOURNAL PLoS Biol 17 (4), e3000194 (2019) PUBMED 30973865 REMARK Publication Status: Online-Only REFERENCE 6 (bases 1 to 1173) AUTHORS Hou,J., Shan,Q., Wang,T., Gomes,A.S., Yan,Q., Paul,D.L., Bleich,M. and Goodenough,D.A. TITLE Transgenic RNAi depletion of claudin-16 and the renal handling of magnesium JOURNAL J Biol Chem 282 (23), 17114-17122 (2007) PUBMED 17442678 REMARK GeneRIF: data suggest that claudin-16 forms a non-selective paracellular cation channel, rather than a selective Mg(2+)/Ca(2+) channel as previously proposed REFERENCE 7 (bases 1 to 1173) AUTHORS Konrad,M., Schaller,A., Seelow,D., Pandey,A.V., Waldegger,S., Lesslauer,A., Vitzthum,H., Suzuki,Y., Luk,J.M., Becker,C., Schlingmann,K.P., Schmid,M., Rodriguez-Soriano,J., Ariceta,G., Cano,F., Enriquez,R., Juppner,H., Bakkaloglu,S.A., Hediger,M.A., Gallati,S., Neuhauss,S.C., Nurnberg,P. and Weber,S. TITLE Mutations in the tight-junction gene claudin 19 (CLDN19) are associated with renal magnesium wasting, renal failure, and severe ocular involvement JOURNAL Am J Hum Genet 79 (5), 949-957 (2006) PUBMED 17033971 REFERENCE 8 (bases 1 to 1173) AUTHORS Ohta,H., Adachi,H. and Inaba,M. TITLE Developmental changes in the expression of tight junction protein claudins in murine metanephroi and embryonic kidneys JOURNAL J Vet Med Sci 68 (2), 149-155 (2006) PUBMED 16520537 REFERENCE 9 (bases 1 to 1173) AUTHORS Hou,J., Paul,D.L. and Goodenough,D.A. TITLE Paracellin-1 and the modulation of ion selectivity of tight junctions JOURNAL J Cell Sci 118 (Pt 21), 5109-5118 (2005) PUBMED 16234325 REFERENCE 10 (bases 1 to 1173) AUTHORS Weber,S., Schlingmann,K.P., Peters,M., Nejsum,L.N., Nielsen,S., Engel,H., Grzeschik,K.H., Seyberth,H.W., Grone,H.J., Nusing,R. and Konrad,M. TITLE Primary gene structure and expression studies of rodent paracellin-1 JOURNAL J Am Soc Nephrol 12 (12), 2664-2672 (2001) PUBMED 11729235 COMMENT REVIEWED REFSEQ: This record has been curated by NCBI staff. The reference sequence was derived from AK085268.1 and AK085333.1. On Aug 11, 2010 this sequence version replaced NM_053241.4. Summary: This gene encodes a member of the claudin family. Claudins are integral membrane proteins and components of tight junction strands. Tight junction strands serve as a physical barrier to prevent solutes and water from passing freely through the paracellular space between epithelial or endothelial cell sheets, and also play critical roles in maintaining cell polarity and signal transductions. The protein encoded by this gene is critical for renal paracellular epithelial transport of Ca(2+) and Mg(2+) in the thick ascending loop of Henle. The gene deficiency leads to specific alterations in renal Ca(2+) and Mg(2+) balance and also to disturbances in Na(+) handling. The interaction of this gene and the Cldn 19 gene is required for their assembly into tight junctions and for renal Mg(2+) reabsorption. This gene and the Cldn1 gene are clustered on chromosome 16. [provided by RefSeq, Aug 2010]. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## Transcript exon combination :: AK085333.1, AK085268.1 [ECO:0000332] RNAseq introns :: single sample supports all introns SAMN00849385 [ECO:0000348] ##Evidence-Data-END## ##RefSeq-Attributes-START## RefSeq Select criteria :: based on single protein-coding transcript ##RefSeq-Attributes-END## PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP 1-1149 AK085268.1 2-1150 1150-1173 AK085333.1 1126-1149 FEATURES Location/Qualifiers source 1..1173 /organism="Mus musculus" /mol_type="mRNA" /strain="C57BL/6" /db_xref="taxon:10090" /chromosome="16" /map="16 18.1 cM" gene 1..1173 /gene="Cldn16" /gene_synonym="claudin-16; PCLN1" /note="claudin 16" /db_xref="GeneID:114141" /db_xref="MGI:MGI:2148742" exon 1..465 /gene="Cldn16" /gene_synonym="claudin-16; PCLN1" /inference="alignment:Splign:2.1.0" misc_feature 259..261 /gene="Cldn16" /gene_synonym="claudin-16; PCLN1" /note="upstream in-frame stop codon" CDS 352..1059 /gene="Cldn16" /gene_synonym="claudin-16; PCLN1" /note="H59D2a protein; paracellin-1" /codon_start=1 /product="claudin-16" /protein_id="NP_444471.1" /db_xref="CCDS:CCDS28088.1" /db_xref="GeneID:114141" /db_xref="MGI:MGI:2148742" /translation="
MKDLLQYAACFLAIFSTGFLIVATWTDCWMVNADDSLEVSTKCRGLWWECVTNAFDGIRTCDEYDSIYAEHPLKLVVTRALMITADILAGFGFITLLLGLDCVKFLPDDPQIKVRLCFVAGTTLLIAGTPGIIGSVWYAVDVYVERSSLVLHNIFLGIQYKFGWSCWLGMAGSLGCFLAGALLTCCLYLFKDVGPERNYPYAMRKPYSTAGVSMAKSYKAPRTETAKMYAVDTRV"
misc_feature 361..423
/gene="Cldn16"
/gene_synonym="claudin-16; PCLN1"
/note="propagated from UniProtKB/Swiss-Prot (Q925N4.1);
transmembrane region"
misc_feature 382..900
/gene="Cldn16"
/gene_synonym="claudin-16; PCLN1"
/note="PMP-22/EMP/MP20/Claudin family; Region:
PMP22_Claudin; cl21598"
/db_xref="CDD:473919"
misc_feature 589..651
/gene="Cldn16"
/gene_synonym="claudin-16; PCLN1"
/note="propagated from UniProtKB/Swiss-Prot (Q925N4.1);
transmembrane region"
misc_feature 697..759
/gene="Cldn16"
/gene_synonym="claudin-16; PCLN1"
/note="propagated from UniProtKB/Swiss-Prot (Q925N4.1);
transmembrane region"
misc_feature 859..921
/gene="Cldn16"
/gene_synonym="claudin-16; PCLN1"
/note="propagated from UniProtKB/Swiss-Prot (Q925N4.1);
transmembrane region"
misc_feature 1048..1056
/gene="Cldn16"
/gene_synonym="claudin-16; PCLN1"
/note="propagated from UniProtKB/Swiss-Prot (Q925N4.1);
Region: Interaction with TJP1.
/evidence=ECO:0000250|UniProtKB:Q91Y55"
exon 466..568
/gene="Cldn16"
/gene_synonym="claudin-16; PCLN1"
/inference="alignment:Splign:2.1.0"
exon 569..733
/gene="Cldn16"
/gene_synonym="claudin-16; PCLN1"
/inference="alignment:Splign:2.1.0"
exon 734..925
/gene="Cldn16"
/gene_synonym="claudin-16; PCLN1"
/inference="alignment:Splign:2.1.0"
exon 926..1173
/gene="Cldn16"
/gene_synonym="claudin-16; PCLN1"
/inference="alignment:Splign:2.1.0"
regulatory 1123..1128
/regulatory_class="polyA_signal_sequence"
/gene="Cldn16"
/gene_synonym="claudin-16; PCLN1"
/note="hexamer: AATAAA"
regulatory 1128..1133
/regulatory_class="polyA_signal_sequence"
/gene="Cldn16"
/gene_synonym="claudin-16; PCLN1"
/note="hexamer: AATAAA"
polyA_site 1141
/gene="Cldn16"
/gene_synonym="claudin-16; PCLN1"
/note="major polyA site"
polyA_site 1154
/gene="Cldn16"
/gene_synonym="claudin-16; PCLN1"
/note="major polyA site"
ORIGIN
cacaggcctctgtgactatcatttcacattagcccacagccaaggctgcttctgccacgaaccaggatgtgcccgggtcttcccctgccctggcttctgattgggagcctggccgctggatagtgacctccacgaccctcgctctggaacaacctgtttatacaattctttctgaagcctaaagtgcctgcaagagggatgtgaggaaacgtgaaagactgggcactatcatccccaggtaccggcgacagagaccaatagcaacagaggcccatagcatcagaagccaatagcattccagctgaactggcatctgcccatgtgtcccttcccaacaggctgtttgctgccatgaaggatcttcttcagtacgctgcctgcttcttggccatattctccactgggtttttgatcgtggccacctggacagactgttggatggtgaacgctgatgactccctggaggtgagcactaaatgcagaggcctgtggtgggagtgtgtaacaaacgcttttgatgggattcgaacctgcgatgagtacgactccatatatgcagaacatcccttgaagctggtggtaactcgagcactgatgatcacagctgacattttagctggctttggattcatcaccctgctccttggtctggactgtgtgaagttcctacctgatgacccacaaattaaagtccgcctttgctttgttgcagggaccacattactcattgcaggtaccccaggaatcatcggttctgtgtggtatgctgtggatgtttacgtcgaacgctcctctctcgttttacacaatatatttcttgggatccaatataaatttggttggtcctgctggcttggaatggctgggtctttgggttgctttttggcaggagctctcctcacctgctgtttgtacctcttcaaagatgttgggcctgagaggaactacccttatgccatgaggaagccctattcaactgcaggtgtgtccatggccaagtcctacaaggcccctcggacagagacagccaaaatgtatgctgtagacaccagagtataaaatctgcccaatgttaatctgtgttcctgtgccgtttaattactcaatcaatgtattcaagttaataaaataaatgatcgactttgaagcattcatttacatttctgatgcaaa
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]