GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2026-07-15 07:57:54, GGRNA.v2 : RefSeq release 233 (Jan, 2026)

LOCUS       NM_053241               1173 bp    mRNA    linear   ROD 20-JUN-2025
DEFINITION  Mus musculus claudin 16 (Cldn16), mRNA.
ACCESSION   NM_053241
VERSION     NM_053241.5
KEYWORDS    RefSeq; RefSeq Select.
SOURCE      Mus musculus (house mouse)
  ORGANISM  Mus musculus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha;
            Muroidea; Muridae; Murinae; Mus; Mus.
REFERENCE   1  (bases 1 to 1173)
  AUTHORS   Adams,D.J., Barlas,B., McIntyre,R.E., Salguero,I., van der
            Weyden,L., Barros,A., Vicente,J.R., Karimpour,N., Haider,A.,
            Ranzani,M., Turner,G., Thompson,N.A., Harle,V., Olvera-Leon,R.,
            Robles-Espinoza,C.D., Speak,A.O., Geisler,N., Weninger,W.J.,
            Geyer,S.H., Hewinson,J., Karp,N.A., Fu,B., Yang,F., Kozik,Z.,
            Choudhary,J., Yu,L., van Ruiten,M.S., Rowland,B.D., Lelliott,C.J.,
            Del Castillo Velasco-Herrera,M., Verstraten,R., Bruckner,L.,
            Henssen,A.G., Rooimans,M.A., de Lange,J., Mohun,T.J., Arends,M.J.,
            Kentistou,K.A., Coelho,P.A., Zhao,Y., Zecchini,H., Perry,J.R.B.,
            Jackson,S.P. and Balmus,G.
  CONSRTM   Sanger Mouse Genetics Project
  TITLE     Genetic determinants of micronucleus formation in vivo
  JOURNAL   Nature 627 (8002), 130-136 (2024)
   PUBMED   38355793
REFERENCE   2  (bases 1 to 1173)
  AUTHORS   Al-Shebel,A., Michel,G., Breiderhoff,T. and Muller,D.
  TITLE     Urinary Acidification Does Not Explain the Absence of
            Nephrocalcinosis in a Mouse Model of Familial Hypomagnesaemia with
            Hypercalciuria and Nephrocalcinosis (FHHNC)
  JOURNAL   Int J Mol Sci 25 (3), 1779 (2024)
   PUBMED   38339056
  REMARK    Publication Status: Online-Only
REFERENCE   3  (bases 1 to 1173)
  AUTHORS   Paes,M.F., Zipinotti Dos Santos,D., Massariol Pimenta,T., Ribeiro
            Junior,R.S., da Silva Martins,B., Greco,S.J., Carvalho,A.A.,
            Bacchi,C., Duarte,C., Carvalho,I., Silva,I.V. and Azevedo
            Rangel,L.B.
  TITLE     Overexpression of CLDN16 in ovarian cancer is modulated by PI3K and
            PKC pathways
  JOURNAL   Exp Cell Res 426 (2), 113523 (2023)
   PUBMED   36889572
  REMARK    GeneRIF: Overexpression of CLDN16 in ovarian cancer is modulated by
            PI3K and PKC pathways.
REFERENCE   4  (bases 1 to 1173)
  AUTHORS   Higashi,A.Y., Higashi,T., Furuse,K., Ozeki,K., Furuse,M. and
            Chiba,H.
  TITLE     Claudin-9 constitutes tight junctions of folliculo-stellate cells
            in the anterior pituitary gland
  JOURNAL   Sci Rep 11 (1), 21642 (2021)
   PUBMED   34737342
  REMARK    Publication Status: Online-Only
REFERENCE   5  (bases 1 to 1173)
  AUTHORS   Ingham,N.J., Pearson,S.A., Vancollie,V.E., Rook,V., Lewis,M.A.,
            Chen,J., Buniello,A., Martelletti,E., Preite,L., Lam,C.C.,
            Weiss,F.D., Powis,Z., Suwannarat,P., Lelliott,C.J., Dawson,S.J.,
            White,J.K. and Steel,K.P.
  TITLE     Mouse screen reveals multiple new genes underlying mouse and human
            hearing loss
  JOURNAL   PLoS Biol 17 (4), e3000194 (2019)
   PUBMED   30973865
  REMARK    Publication Status: Online-Only
REFERENCE   6  (bases 1 to 1173)
  AUTHORS   Hou,J., Shan,Q., Wang,T., Gomes,A.S., Yan,Q., Paul,D.L., Bleich,M.
            and Goodenough,D.A.
  TITLE     Transgenic RNAi depletion of claudin-16 and the renal handling of
            magnesium
  JOURNAL   J Biol Chem 282 (23), 17114-17122 (2007)
   PUBMED   17442678
  REMARK    GeneRIF: data suggest that claudin-16 forms a non-selective
            paracellular cation channel, rather than a selective Mg(2+)/Ca(2+)
            channel as previously proposed
REFERENCE   7  (bases 1 to 1173)
  AUTHORS   Konrad,M., Schaller,A., Seelow,D., Pandey,A.V., Waldegger,S.,
            Lesslauer,A., Vitzthum,H., Suzuki,Y., Luk,J.M., Becker,C.,
            Schlingmann,K.P., Schmid,M., Rodriguez-Soriano,J., Ariceta,G.,
            Cano,F., Enriquez,R., Juppner,H., Bakkaloglu,S.A., Hediger,M.A.,
            Gallati,S., Neuhauss,S.C., Nurnberg,P. and Weber,S.
  TITLE     Mutations in the tight-junction gene claudin 19 (CLDN19) are
            associated with renal magnesium wasting, renal failure, and severe
            ocular involvement
  JOURNAL   Am J Hum Genet 79 (5), 949-957 (2006)
   PUBMED   17033971
REFERENCE   8  (bases 1 to 1173)
  AUTHORS   Ohta,H., Adachi,H. and Inaba,M.
  TITLE     Developmental changes in the expression of tight junction protein
            claudins in murine metanephroi and embryonic kidneys
  JOURNAL   J Vet Med Sci 68 (2), 149-155 (2006)
   PUBMED   16520537
REFERENCE   9  (bases 1 to 1173)
  AUTHORS   Hou,J., Paul,D.L. and Goodenough,D.A.
  TITLE     Paracellin-1 and the modulation of ion selectivity of tight
            junctions
  JOURNAL   J Cell Sci 118 (Pt 21), 5109-5118 (2005)
   PUBMED   16234325
REFERENCE   10 (bases 1 to 1173)
  AUTHORS   Weber,S., Schlingmann,K.P., Peters,M., Nejsum,L.N., Nielsen,S.,
            Engel,H., Grzeschik,K.H., Seyberth,H.W., Grone,H.J., Nusing,R. and
            Konrad,M.
  TITLE     Primary gene structure and expression studies of rodent
            paracellin-1
  JOURNAL   J Am Soc Nephrol 12 (12), 2664-2672 (2001)
   PUBMED   11729235
COMMENT     REVIEWED REFSEQ: This record has been curated by NCBI staff. The
            reference sequence was derived from AK085268.1 and AK085333.1.
            
            On Aug 11, 2010 this sequence version replaced NM_053241.4.
            
            Summary: This gene encodes a member of the claudin family. Claudins
            are integral membrane proteins and components of tight junction
            strands. Tight junction strands serve as a physical barrier to
            prevent solutes and water from passing freely through the
            paracellular space between epithelial or endothelial cell sheets,
            and also play critical roles in maintaining cell polarity and
            signal transductions. The protein encoded by this gene is critical
            for renal paracellular epithelial transport of Ca(2+) and Mg(2+) in
            the thick ascending loop of Henle. The gene deficiency leads to
            specific alterations in renal Ca(2+) and Mg(2+) balance and also to
            disturbances in Na(+) handling. The interaction of this gene and
            the Cldn 19 gene is required for their assembly into tight
            junctions and for renal Mg(2+) reabsorption. This gene and the
            Cldn1 gene are clustered on chromosome 16. [provided by RefSeq, Aug
            2010].
            
            Publication Note:  This RefSeq record includes a subset of the
            publications that are available for this gene. Please see the Gene
            record to access additional publications.
            
            ##Evidence-Data-START##
            Transcript exon combination :: AK085333.1, AK085268.1 [ECO:0000332]
            RNAseq introns              :: single sample supports all introns
                                           SAMN00849385 [ECO:0000348]
            ##Evidence-Data-END##
            
            ##RefSeq-Attributes-START##
            RefSeq Select criteria :: based on single protein-coding transcript
            ##RefSeq-Attributes-END##
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-1149              AK085268.1         2-1150
            1150-1173           AK085333.1         1126-1149
FEATURES             Location/Qualifiers
     source          1..1173
                     /organism="Mus musculus"
                     /mol_type="mRNA"
                     /strain="C57BL/6"
                     /db_xref="taxon:10090"
                     /chromosome="16"
                     /map="16 18.1 cM"
     gene            1..1173
                     /gene="Cldn16"
                     /gene_synonym="claudin-16; PCLN1"
                     /note="claudin 16"
                     /db_xref="GeneID:114141"
                     /db_xref="MGI:MGI:2148742"
     exon            1..465
                     /gene="Cldn16"
                     /gene_synonym="claudin-16; PCLN1"
                     /inference="alignment:Splign:2.1.0"
     misc_feature    259..261
                     /gene="Cldn16"
                     /gene_synonym="claudin-16; PCLN1"
                     /note="upstream in-frame stop codon"
     CDS             352..1059
                     /gene="Cldn16"
                     /gene_synonym="claudin-16; PCLN1"
                     /note="H59D2a protein; paracellin-1"
                     /codon_start=1
                     /product="claudin-16"
                     /protein_id="NP_444471.1"
                     /db_xref="CCDS:CCDS28088.1"
                     /db_xref="GeneID:114141"
                     /db_xref="MGI:MGI:2148742"
                     /translation="
MKDLLQYAACFLAIFSTGFLIVATWTDCWMVNADDSLEVSTKCRGLWWECVTNAFDGIRTCDEYDSIYAEHPLKLVVTRALMITADILAGFGFITLLLGLDCVKFLPDDPQIKVRLCFVAGTTLLIAGTPGIIGSVWYAVDVYVERSSLVLHNIFLGIQYKFGWSCWLGMAGSLGCFLAGALLTCCLYLFKDVGPERNYPYAMRKPYSTAGVSMAKSYKAPRTETAKMYAVDTRV"
     misc_feature    361..423
                     /gene="Cldn16"
                     /gene_synonym="claudin-16; PCLN1"
                     /note="propagated from UniProtKB/Swiss-Prot (Q925N4.1);
                     transmembrane region"
     misc_feature    382..900
                     /gene="Cldn16"
                     /gene_synonym="claudin-16; PCLN1"
                     /note="PMP-22/EMP/MP20/Claudin family; Region:
                     PMP22_Claudin; cl21598"
                     /db_xref="CDD:473919"
     misc_feature    589..651
                     /gene="Cldn16"
                     /gene_synonym="claudin-16; PCLN1"
                     /note="propagated from UniProtKB/Swiss-Prot (Q925N4.1);
                     transmembrane region"
     misc_feature    697..759
                     /gene="Cldn16"
                     /gene_synonym="claudin-16; PCLN1"
                     /note="propagated from UniProtKB/Swiss-Prot (Q925N4.1);
                     transmembrane region"
     misc_feature    859..921
                     /gene="Cldn16"
                     /gene_synonym="claudin-16; PCLN1"
                     /note="propagated from UniProtKB/Swiss-Prot (Q925N4.1);
                     transmembrane region"
     misc_feature    1048..1056
                     /gene="Cldn16"
                     /gene_synonym="claudin-16; PCLN1"
                     /note="propagated from UniProtKB/Swiss-Prot (Q925N4.1);
                     Region: Interaction with TJP1.
                     /evidence=ECO:0000250|UniProtKB:Q91Y55"
     exon            466..568
                     /gene="Cldn16"
                     /gene_synonym="claudin-16; PCLN1"
                     /inference="alignment:Splign:2.1.0"
     exon            569..733
                     /gene="Cldn16"
                     /gene_synonym="claudin-16; PCLN1"
                     /inference="alignment:Splign:2.1.0"
     exon            734..925
                     /gene="Cldn16"
                     /gene_synonym="claudin-16; PCLN1"
                     /inference="alignment:Splign:2.1.0"
     exon            926..1173
                     /gene="Cldn16"
                     /gene_synonym="claudin-16; PCLN1"
                     /inference="alignment:Splign:2.1.0"
     regulatory      1123..1128
                     /regulatory_class="polyA_signal_sequence"
                     /gene="Cldn16"
                     /gene_synonym="claudin-16; PCLN1"
                     /note="hexamer: AATAAA"
     regulatory      1128..1133
                     /regulatory_class="polyA_signal_sequence"
                     /gene="Cldn16"
                     /gene_synonym="claudin-16; PCLN1"
                     /note="hexamer: AATAAA"
     polyA_site      1141
                     /gene="Cldn16"
                     /gene_synonym="claudin-16; PCLN1"
                     /note="major polyA site"
     polyA_site      1154
                     /gene="Cldn16"
                     /gene_synonym="claudin-16; PCLN1"
                     /note="major polyA site"
ORIGIN      
cacaggcctctgtgactatcatttcacattagcccacagccaaggctgcttctgccacgaaccaggatgtgcccgggtcttcccctgccctggcttctgattgggagcctggccgctggatagtgacctccacgaccctcgctctggaacaacctgtttatacaattctttctgaagcctaaagtgcctgcaagagggatgtgaggaaacgtgaaagactgggcactatcatccccaggtaccggcgacagagaccaatagcaacagaggcccatagcatcagaagccaatagcattccagctgaactggcatctgcccatgtgtcccttcccaacaggctgtttgctgccatgaaggatcttcttcagtacgctgcctgcttcttggccatattctccactgggtttttgatcgtggccacctggacagactgttggatggtgaacgctgatgactccctggaggtgagcactaaatgcagaggcctgtggtgggagtgtgtaacaaacgcttttgatgggattcgaacctgcgatgagtacgactccatatatgcagaacatcccttgaagctggtggtaactcgagcactgatgatcacagctgacattttagctggctttggattcatcaccctgctccttggtctggactgtgtgaagttcctacctgatgacccacaaattaaagtccgcctttgctttgttgcagggaccacattactcattgcaggtaccccaggaatcatcggttctgtgtggtatgctgtggatgtttacgtcgaacgctcctctctcgttttacacaatatatttcttgggatccaatataaatttggttggtcctgctggcttggaatggctgggtctttgggttgctttttggcaggagctctcctcacctgctgtttgtacctcttcaaagatgttgggcctgagaggaactacccttatgccatgaggaagccctattcaactgcaggtgtgtccatggccaagtcctacaaggcccctcggacagagacagccaaaatgtatgctgtagacaccagagtataaaatctgcccaatgttaatctgtgttcctgtgccgtttaattactcaatcaatgtattcaagttaataaaataaatgatcgactttgaagcattcatttacatttctgatgcaaa
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]