GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2019-03-23 04:11:35, GGRNA.v2 : RefSeq release 92 (Jan, 2019)

LOCUS       NM_023951                567 bp    mRNA    linear   ROD 11-NOV-2018
DEFINITION  Rattus norvegicus SEBOX homeobox (Sebox), mRNA.
ACCESSION   NM_023951
VERSION     NM_023951.1
KEYWORDS    RefSeq.
SOURCE      Rattus norvegicus (Norway rat)
  ORGANISM  Rattus norvegicus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha;
            Muroidea; Muridae; Murinae; Rattus.
REFERENCE   1  (bases 1 to 567)
  AUTHORS   Moreno DL, Salazar Z, Betancourt M, Casas E, Ducolomb Y, Gonzalez C
            and Bonilla E.
  TITLE     Sebox plays an important role during the early mouse oogenesis in
            vitro
  JOURNAL   Zygote 22 (1), 64-68 (2014)
   PUBMED   22805237
REFERENCE   2  (bases 1 to 567)
  AUTHORS   Kim KH, Kim EY and Lee KA.
  TITLE     SEBOX is essential for early embryogenesis at the two-cell stage in
            the mouse
  JOURNAL   Biol. Reprod. 79 (6), 1192-1201 (2008)
   PUBMED   18753614
REFERENCE   3  (bases 1 to 567)
  AUTHORS   Cinquanta M, Rovescalli AC, Kozak CA and Nirenberg M.
  TITLE     Mouse Sebox homeobox gene expression in skin, brain, oocytes, and
            two-cell embryos
  JOURNAL   Proc. Natl. Acad. Sci. U.S.A. 97 (16), 8904-8909 (2000)
   PUBMED   10922053
COMMENT     PROVISIONAL REFSEQ: This record has not yet been subject to final
            NCBI review. The reference sequence was derived from AF284338.1.
            
            Summary: paired-like homeobox containing gene; mouse homolog is
            maternally expressed [RGD, Feb 2006].
            
            ##Evidence-Data-START##
            RNAseq introns :: single sample supports all introns SAMD00052296,
                              SAMD00052297 [ECO:0000348]
            ##Evidence-Data-END##
FEATURES             Location/Qualifiers
     source          1..567
                     /organism="Rattus norvegicus"
                     /mol_type="mRNA"
                     /strain="Sprague-Dawley"
                     /db_xref="taxon:10116"
                     /chromosome="10"
                     /map="10q25"
     gene            1..567
                     /gene="Sebox"
                     /gene_synonym="Og9x"
                     /note="SEBOX homeobox"
                     /db_xref="GeneID:58922"
                     /db_xref="RGD:62077"
     CDS             1..567
                     /gene="Sebox"
                     /gene_synonym="Og9x"
                     /note="homeobox OG-9; skin-, embryo-, brain- and
                     oocyte-specific homeobox; OG9 homeobox"
                     /codon_start=1
                     /product="homeobox protein SEBOX"
                     /protein_id="NP_076441.1"
                     /db_xref="GeneID:58922"
                     /db_xref="RGD:62077"
                     /translation="
MASPVEASPGCASGLGPHRRKRTTFSVGQLLELERVFAARPYPDISTREHLAQITHLPEAKIQVWFQNRRAKRIKDRKPGALNARLELPPNCSLPDTPQLSWDPGTPSHPLHSTSSAQQTSACPPQTSCLAPILGPGQSWSGAKAAAPWGTSEVSGVHSLEQIVPQTSLGNLSDLIYTSAIVTNVDHS"
     misc_feature    <37..363
                     /gene="Sebox"
                     /gene_synonym="Og9x"
                     /note="Homeodomain-containing transcription factor
                     [Transcription]; Region: COG5576"
                     /db_xref="CDD:227863"
     misc_feature    order(55..69,73..75,124..126,142..144,181..183,187..192,
                     199..204,208..216)
                     /gene="Sebox"
                     /gene_synonym="Og9x"
                     /note="DNA binding site [nucleotide binding]"
                     /db_xref="CDD:238039"
     misc_feature    61..216
                     /gene="Sebox"
                     /gene_synonym="Og9x"
                     /note="Homeobox domain; Region: Homeobox; pfam00046"
                     /db_xref="CDD:278475"
     misc_feature    order(61..63,70..72,190..192,199..204,211..213)
                     /gene="Sebox"
                     /gene_synonym="Og9x"
                     /note="specific DNA base contacts [nucleotide binding];
                     other site"
                     /db_xref="CDD:238039"
     exon            1..28
                     /gene="Sebox"
                     /gene_synonym="Og9x"
                     /inference="alignment:Splign:2.0.8"
     exon            29..189
                     /gene="Sebox"
                     /gene_synonym="Og9x"
                     /inference="alignment:Splign:2.0.8"
     exon            190..567
                     /gene="Sebox"
                     /gene_synonym="Og9x"
                     /inference="alignment:Splign:2.0.8"
ORIGIN      
atggccagtcctgtggaggcatctccaggctgtgccagtgggttgggtccccatcggaggaagaggaccacttttagtgttgggcagttgctggagctggaacgggtatttgcagctaggccctatcctgacatcagcacccgtgagcacctggctcagataactcacctgccagaagccaagatccaggtgtggttccagaaccgtcgagccaagagaatcaaggacagaaagccaggagccctaaacgccaggctggagcttcccccaaactgttctcttccagacactccccagctatcttgggaccctggaacaccaagccatcctctacactctaccagttcagctcagcagacttcggcatgcccaccacagacctcctgcctagcccccattttgggtccagggcagagttggtcaggggctaaagctgcagccccatgggggacaagtgaggtgtcaggagttcactctttagagcaaattgttcctcagacttcactgggcaacctgtctgaccttatctatacctcagccatcgtcaccaatgtagaccactcctaa
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]