2025-07-12 09:26:35, GGRNA.v2 : RefSeq release 229 (Mar, 2025)
LOCUS NM_017339 1060 bp mRNA linear ROD 08-OCT-2024 DEFINITION Rattus norvegicus ISL LIM homeobox 1 (Isl1), mRNA. ACCESSION NM_017339 VERSION NM_017339.3 KEYWORDS RefSeq; RefSeq Select. SOURCE Rattus norvegicus (Norway rat) ORGANISM Rattus norvegicus Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha; Muroidea; Muridae; Murinae; Rattus. REFERENCE 1 (bases 1 to 1060) AUTHORS Zhang,J., Zhang,R., Liu,C., Ge,X., Wang,Y., Jiang,F., Zhuang,L., Li,T., Zhu,Q., Jiang,Y., Chen,Y., Lu,M., Wang,Y., Jiang,M., Liu,Y. and Liu,L. TITLE Missense mutation of ISL1 (E283D) is associated with the development of type 2 diabetes JOURNAL Diabetologia 67 (8), 1698-1713 (2024) PUBMED 38819467 REMARK GeneRIF: Missense mutation of ISL1 (E283D) is associated with the development of type 2 diabetes. REFERENCE 2 (bases 1 to 1060) AUTHORS Wu,S.H., Wang,X.H., Xu,Y.J., Gu,J.N., Yang,C.X., Qiao,Q., Guo,X.J., Guo,Y.H., Qiu,X.B., Jiang,W.F. and Yang,Y.Q. TITLE ISL1 loss-of-function variation causes familial atrial fibrillation JOURNAL Eur J Med Genet 63 (11), 104029 (2020) PUBMED 32771629 REFERENCE 3 (bases 1 to 1060) AUTHORS Sun,Q., Zeng,J., Liu,Y., Chen,J., Zeng,Q.C., Chen,Y.Q., Tu,L.L., Chen,P., Yang,F. and Zhang,M. TITLE microRNA-9 and -29a regulate the progression of diabetic peripheral neuropathy via ISL1-mediated sonic hedgehog signaling pathway JOURNAL Aging (Albany NY) 12 (12), 11446-11465 (2020) PUBMED 32544883 REFERENCE 4 (bases 1 to 1060) AUTHORS Liang,L., Su,W., Zhou,L., Cao,Y., Zhou,X., Liu,S., Zhao,Y., Ding,X., Wang,Q. and Zhang,H. TITLE Statin downregulation of miR-652-3p protects endothelium from dyslipidemia by promoting ISL1 expression JOURNAL Metabolism 107, 154226 (2020) PUBMED 32277945 REFERENCE 5 (bases 1 to 1060) AUTHORS Wang,Z., Song,H.M., Wang,F., Zhao,C.M., Huang,R.T., Xue,S., Li,R.G., Qiu,X.B., Xu,Y.J., Liu,X.Y. and Yang,Y.Q. TITLE A New ISL1 Loss-of-Function Mutation Predisposes to Congenital Double Outlet Right Ventricle JOURNAL Int Heart J 60 (5), 1113-1122 (2019) PUBMED 31484864 REFERENCE 6 (bases 1 to 1060) AUTHORS Ahlgren,U., Pfaff,S.L., Jessell,T.M., Edlund,T. and Edlund,H. TITLE Independent requirement for ISL1 in formation of pancreatic mesenchyme and islet cells JOURNAL Nature 385 (6613), 257-260 (1997) PUBMED 9000074 REFERENCE 7 (bases 1 to 1060) AUTHORS Pfaff,S.L., Mendelsohn,M., Stewart,C.L., Edlund,T. and Jessell,T.M. TITLE Requirement for LIM homeobox gene Isl1 in motor neuron generation reveals a motor neuron-dependent step in interneuron differentiation JOURNAL Cell 84 (2), 309-320 (1996) PUBMED 8565076 REFERENCE 8 (bases 1 to 1060) AUTHORS Wang,M. and Drucker,D.J. TITLE The LIM domain homeobox gene isl-1 is a positive regulator of islet cell-specific proglucagon gene transcription JOURNAL J Biol Chem 270 (21), 12646-12652 (1995) PUBMED 7759514 REFERENCE 9 (bases 1 to 1060) AUTHORS Wang,M. and Drucker,D.J. TITLE The LIM domain homeobox gene isl-1: conservation of human, hamster, and rat complementary deoxyribonucleic acid sequences and expression in cell types of nonneuroendocrine lineage JOURNAL Endocrinology 134 (3), 1416-1422 (1994) PUBMED 7907017 REFERENCE 10 (bases 1 to 1060) AUTHORS Karlsson,O., Thor,S., Norberg,T., Ohlsson,H. and Edlund,T. TITLE Insulin gene enhancer binding protein Isl-1 is a member of a novel class of proteins containing both a homeo- and a Cys-His domain JOURNAL Nature 344 (6269), 879-882 (1990) PUBMED 1691825 COMMENT PROVISIONAL REFSEQ: This record has not yet been subject to final NCBI review. The reference sequence was derived from S69329.1. On Apr 28, 2006 this sequence version replaced NM_017339.2. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## Transcript exon combination :: S69329.1 [ECO:0000332] RNAseq introns :: single sample supports all introns SAMEA5760389 [ECO:0000348] ##Evidence-Data-END## ##RefSeq-Attributes-START## RefSeq Select criteria :: based on single protein-coding transcript ##RefSeq-Attributes-END## FEATURES Location/Qualifiers source 1..1060 /organism="Rattus norvegicus" /mol_type="mRNA" /db_xref="taxon:10116" /chromosome="2" /map="2q14" gene 1..1060 /gene="Isl1" /gene_synonym="Isl-1; isl-1=homeobox" /note="ISL LIM homeobox 1" /db_xref="GeneID:64444" /db_xref="RGD:61957" exon 1..33 /gene="Isl1" /gene_synonym="Isl-1; isl-1=homeobox" /inference="alignment:Splign:2.1.0" CDS 6..1055 /gene="Isl1" /gene_synonym="Isl-1; isl-1=homeobox" /note="islet-1; isl-1 homeobox; ISL1 transcription factor, LIM/homeodomain 1; ISL1 transcription factor LIM/homeodomain (islet-1)" /codon_start=1 /product="insulin gene enhancer protein ISL-1" /protein_id="NP_059035.3" /db_xref="GeneID:64444" /db_xref="RGD:61957" /translation="
MGDMGDPPKKKRLISLCVGCGNQIHDQYILRVSPDLEWHAACLKCAECNQYLDESCTCFVRDGKTYCKRDYIRLYGIKCAKCSIGFSKNDFVMRARSKVYHIECFRCVACSRQLIPGDEFALREDGLFCRADHDVVERASLGAGDPLSPLHPARPLQMAAEPISARQPALRPHVHKQPEKTTRVRTVLNEKQLHTLRTCYAANPRPDALMKEQLVEMTGLSPRVIRVWFQNKRCKDKKRSIMMKQLQQQQPNDKTNIQGMTGTPMVAASPERHDGGLQANPVEVQSYQPPWKVLSDFALQSDIDQPAFQQLVNFSEGGPGSNSTGSEVASMSSQLPDTPNSMVASPIEA"
misc_feature 54..218 /gene="Isl1" /gene_synonym="Isl-1; isl-1=homeobox" /note="The first LIM domain of Isl, a member of LHX protein family; Region: LIM1_Isl; cd09366" /db_xref="CDD:188752" misc_feature order(54..56,63..65,120..122,129..131,138..140,147..149, 204..206,213..215) /gene="Isl1" /gene_synonym="Isl-1; isl-1=homeobox" /note="Zn binding site [ion binding]; other site" /db_xref="CDD:188752" misc_feature 240..404 /gene="Isl1" /gene_synonym="Isl-1; isl-1=homeobox" /note="The second LIM domain of Isl, a member of LHX protein family; Region: LIM2_Isl; cd09374" /db_xref="CDD:188760" misc_feature order(240..242,249..251,306..308,315..317,324..326, 333..335,390..392,399..401) /gene="Isl1" /gene_synonym="Isl-1; isl-1=homeobox" /note="Zn binding site [ion binding]; other site" /db_xref="CDD:188760" misc_feature 546..716 /gene="Isl1" /gene_synonym="Isl-1; isl-1=homeobox" /note="Homeodomain; Region: HOX; smart00389" /db_xref="CDD:197696" misc_feature order(552..563,567..569,618..620,636..638,675..677, 681..686,693..698,702..710,714..719) /gene="Isl1" /gene_synonym="Isl-1; isl-1=homeobox" /note="DNA binding site [nucleotide binding]" /db_xref="CDD:238039" misc_feature order(555..557,564..566,684..686,693..698,705..707) /gene="Isl1" /gene_synonym="Isl-1; isl-1=homeobox" /note="specific DNA base contacts [nucleotide binding]; other site" /db_xref="CDD:238039" misc_feature 789..878 /gene="Isl1" /gene_synonym="Isl-1; isl-1=homeobox" /note="propagated from UniProtKB/Swiss-Prot (P61374.1); Region: LIM-binding domain (LID). /evidence=ECO:0000250" misc_feature 939..1052 /gene="Isl1" /gene_synonym="Isl-1; isl-1=homeobox" /note="propagated from UniProtKB/Swiss-Prot (P61374.1); Region: Disordered. /evidence=ECO:0000256|SAM:MobiDB-lite" exon 34..223 /gene="Isl1" /gene_synonym="Isl-1; isl-1=homeobox" /inference="alignment:Splign:2.1.0" exon 224..483 /gene="Isl1" /gene_synonym="Isl-1; isl-1=homeobox" /inference="alignment:Splign:2.1.0" exon 484..770 /gene="Isl1" /gene_synonym="Isl-1; isl-1=homeobox" /inference="alignment:Splign:2.1.0" exon 771..938 /gene="Isl1" /gene_synonym="Isl-1; isl-1=homeobox" /inference="alignment:Splign:2.1.0" exon 939..1060 /gene="Isl1" /gene_synonym="Isl-1; isl-1=homeobox" /inference="alignment:Splign:2.1.0" ORIGIN
cagatatgggagacatgggcgatccaccaaaaaaaaaacgtctgatttccctatgtgttggttgcggtaatcaaattcacgatcagtatattctgagggtttctccggatttggaatggcatgcggcatgtttgaaatgtgcggagtgtaatcagtatttggacgaaagctgtacctgctttgttagggacgggaaaacctactgtaaaagagattatatcaggttgtacgggatcaaatgcgccaagtgcagcataggcttcagcaagaacgacttcgtgatgcgcgcccgctctaaggtgtaccacatcgaatgtttccgctgtgtagcatgcagccgacagctcatcccgggagacgaattcgcgctgcgggaggatgggcttttctgccgcgcggaccacgatgtagtggagagggccagcctaggagctggagaccctctcagtcccttgcatccagcgcggcctctgcaaatggcagccgagcccatctccgctaggcagccagctctgcggccgcacgtccacaaacagcccgagaagaccacccgagtgcggactgtgctcaacgaaaagcagctgcacaccttgcggacctgctacgcagccaaccctcggccagatgcgctcatgaaggagcaactagtggagatgaccggcctcagtccccgagtcatccgggtctggtttcaaaacaagaggtgcaaggacaagaaacgcagcatcatgatgaagcagctccagcagcagcaacccaacgacaaaactaatatccaggggatgacaggaactcccatggtggctgctagtccggagagacatgatggtggtttacaggctaacccagttgaggtgcaaagttaccagccgccctggaaagtactgagtgacttcgccttgcaaagtgacatagatcagcctgcttttcagcaactggtcaatttttcagaaggaggaccaggctctaattccactggcagtgaagtagcatcgatgtcctctcagctcccagatacacccaacagcatggtagccagtcctatagaggcatgaggaac
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]