GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2024-07-23 23:41:26, GGRNA.v2 : RefSeq release 224 (May, 2024)

LOCUS       NM_017275               1619 bp    mRNA    linear   ROD 28-MAR-2024
DEFINITION  Rattus norvegicus pregnancy up-regulated nonubiquitous CaM kinase
            (Pnck), mRNA.
ACCESSION   NM_017275
VERSION     NM_017275.2
KEYWORDS    RefSeq; RefSeq Select.
SOURCE      Rattus norvegicus (Norway rat)
  ORGANISM  Rattus norvegicus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha;
            Muroidea; Muridae; Murinae; Rattus.
REFERENCE   1  (bases 1 to 1619)
  AUTHORS   Tokumitsu,H., Iwabu,M., Ishikawa,Y. and Kobayashi,R.
  TITLE     Differential regulatory mechanism of Ca2+/calmodulin-dependent
            protein kinase kinase isoforms
  JOURNAL   Biochemistry 40 (46), 13925-13932 (2001)
   PUBMED   11705382
  REMARK    GeneRIF: Residues 129-151 of recombinant CaM-KK beta participate in
            the release of the autoinhibitory domain from its catalytic core,
            resulting in generation of autonomous activity.
REFERENCE   2  (bases 1 to 1619)
  AUTHORS   Hook,S.S. and Means,A.R.
  TITLE     Ca(2+)/CaM-dependent kinases: from activation to function
  JOURNAL   Annu Rev Pharmacol Toxicol 41, 471-505 (2001)
   PUBMED   11264466
  REMARK    Review article
REFERENCE   3  (bases 1 to 1619)
  AUTHORS   Naito,Y., Watanabe,Y., Yokokura,H., Sugita,R., Nishio,M. and
            Hidaka,H.
  TITLE     Isoform-specific activation and structural diversity of calmodulin
            kinase I
  JOURNAL   J Biol Chem 272 (51), 32704-32708 (1997)
   PUBMED   9405489
REFERENCE   4  (bases 1 to 1619)
  AUTHORS   Yokokura,H., Terada,O., Naito,Y. and Hidaka,H.
  TITLE     Isolation and comparison of rat cDNAs encoding
            Ca2+/calmodulin-dependent protein kinase I isoforms
  JOURNAL   Biochim Biophys Acta 1338 (1), 8-12 (1997)
   PUBMED   9074610
COMMENT     PROVISIONAL REFSEQ: This record has not yet been subject to final
            NCBI review. The reference sequence was derived from
            JAXUCZ010000021.1.
            
            On Nov 26, 2020 this sequence version replaced NM_017275.1.
            
            ##Evidence-Data-START##
            Transcript exon combination :: AB004267.1, SRR26360194.2401531.1
                                           [ECO:0000332]
            RNAseq introns              :: mixed sample support SAMEA5760383,
                                           SAMEA5760386 [ECO:0006172]
            ##Evidence-Data-END##
            
            ##RefSeq-Attributes-START##
            RefSeq Select criteria :: based on conservation, expression
            ##RefSeq-Attributes-END##
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-212               JAXUCZ010000021.1  156524442-156524653 c
            213-282             JAXUCZ010000021.1  156523914-156523983 c
            283-414             JAXUCZ010000021.1  156523435-156523566 c
            415-489             JAXUCZ010000021.1  156523018-156523092 c
            490-628             JAXUCZ010000021.1  156522786-156522924 c
            629-752             JAXUCZ010000021.1  156522484-156522607 c
            753-828             JAXUCZ010000021.1  156522202-156522277 c
            829-941             JAXUCZ010000021.1  156521995-156522107 c
            942-1020            JAXUCZ010000021.1  156521837-156521915 c
            1021-1108           JAXUCZ010000021.1  156521678-156521765 c
            1109-1253           JAXUCZ010000021.1  156521405-156521549 c
            1254-1619           JAXUCZ010000021.1  156520753-156521118 c
FEATURES             Location/Qualifiers
     source          1..1619
                     /organism="Rattus norvegicus"
                     /mol_type="mRNA"
                     /strain="BN"
                     /db_xref="taxon:10116"
                     /chromosome="X"
                     /map="Xq37"
     gene            1..1619
                     /gene="Pnck"
                     /gene_synonym="Camk1b"
                     /note="pregnancy up-regulated nonubiquitous CaM kinase"
                     /db_xref="GeneID:29660"
                     /db_xref="RGD:69249"
     exon            1..212
                     /gene="Pnck"
                     /gene_synonym="Camk1b"
                     /inference="alignment:Splign:2.1.0"
     misc_feature    185..187
                     /gene="Pnck"
                     /gene_synonym="Camk1b"
                     /note="upstream in-frame stop codon"
     exon            213..282
                     /gene="Pnck"
                     /gene_synonym="Camk1b"
                     /inference="alignment:Splign:2.1.0"
     CDS             215..1246
                     /gene="Pnck"
                     /gene_synonym="Camk1b"
                     /EC_number="2.7.11.17"
                     /note="calcium/calmodulin-dependent protein kinase 1,
                     beta; caMKI-beta; caM-KI beta; caM kinase IB; caM kinase I
                     beta; Protein Kinase-like; pregnancy up-regulated
                     non-ubiquitously-expressed CaM kinase homolog; pregnancy
                     upregulated non-ubiquitously expressed CaM kinase"
                     /codon_start=1
                     /product="calcium/calmodulin-dependent protein kinase type
                     1B"
                     /protein_id="NP_058971.1"
                     /db_xref="GeneID:29660"
                     /db_xref="RGD:69249"
                     /translation="
MLLLKKQTEDISSVYEIREKLGSGAFSEVMLAQERGSAHLVALKCIPKKALRGKEALVENEIAVLRRISHPNIVALEDVHESPSHLYLAMELVTGGELFDRIMERGSYTEKDASHLVGQVLGAVSYLHSLGIVHRDLKPENLLYATPFEDSKIMVSDFGLSKIQAGNMLGTACGTPGYVAPELLEQKPYGKAVDVWALGVISYILLCGYPPFYDESDPELFSQILRASYEFDSPFWDDISESAKDFIRHLLERDPQKRFTCQQALQHLWISGDAALDRDILGSVSEQIQKNFARTHWKRAFNATSFLRHIRKLGQSPEGEEASRQGMTRHSHPGLGTSQSPKW"
     misc_feature    245..1075
                     /gene="Pnck"
                     /gene_synonym="Camk1b"
                     /note="Catalytic domain of the Serine/Threonine kinase,
                     Calcium/calmodulin-dependent protein kinase Type I beta;
                     Region: STKc_CaMKI_beta; cd14169"
                     /db_xref="CDD:271071"
     misc_feature    order(275..289,299..301,338..340,344..346,434..436,
                     482..493,503..505,509..511,617..622,626..628,632..637,
                     641..643,680..685,692..694,731..745,749..751)
                     /gene="Pnck"
                     /gene_synonym="Camk1b"
                     /note="active site"
                     /db_xref="CDD:271071"
     misc_feature    order(275..286,299..301,338..340,344..346,434..436,
                     482..493,503..505,632..637,641..643,680..685)
                     /gene="Pnck"
                     /gene_synonym="Camk1b"
                     /note="ATP binding site [chemical binding]; other site"
                     /db_xref="CDD:271071"
     misc_feature    order(287..289,503..505,509..511,617..622,626..628,
                     632..634,692..694,731..745,749..751)
                     /gene="Pnck"
                     /gene_synonym="Camk1b"
                     /note="polypeptide substrate binding site [polypeptide
                     binding]; other site"
                     /db_xref="CDD:271071"
     misc_feature    680..745
                     /gene="Pnck"
                     /gene_synonym="Camk1b"
                     /note="activation loop (A-loop); other site"
                     /db_xref="CDD:271071"
     misc_feature    1082..1147
                     /gene="Pnck"
                     /gene_synonym="Camk1b"
                     /note="propagated from UniProtKB/Swiss-Prot (O70150.1);
                     Region: Calmodulin-binding. /evidence=ECO:0000250"
     misc_feature    1154..1243
                     /gene="Pnck"
                     /gene_synonym="Camk1b"
                     /note="propagated from UniProtKB/Swiss-Prot (O70150.1);
                     Region: Disordered. /evidence=ECO:0000256|SAM:MobiDB-lite"
     misc_feature    1226..1228
                     /gene="Pnck"
                     /gene_synonym="Camk1b"
                     /note="Phosphoserine.
                     /evidence=ECO:0000250|UniProtKB:Q9QYK9; propagated from
                     UniProtKB/Swiss-Prot (O70150.1); phosphorylation site"
     exon            283..414
                     /gene="Pnck"
                     /gene_synonym="Camk1b"
                     /inference="alignment:Splign:2.1.0"
     exon            415..489
                     /gene="Pnck"
                     /gene_synonym="Camk1b"
                     /inference="alignment:Splign:2.1.0"
     exon            490..628
                     /gene="Pnck"
                     /gene_synonym="Camk1b"
                     /inference="alignment:Splign:2.1.0"
     exon            629..752
                     /gene="Pnck"
                     /gene_synonym="Camk1b"
                     /inference="alignment:Splign:2.1.0"
     exon            753..828
                     /gene="Pnck"
                     /gene_synonym="Camk1b"
                     /inference="alignment:Splign:2.1.0"
     exon            829..941
                     /gene="Pnck"
                     /gene_synonym="Camk1b"
                     /inference="alignment:Splign:2.1.0"
     exon            942..1020
                     /gene="Pnck"
                     /gene_synonym="Camk1b"
                     /inference="alignment:Splign:2.1.0"
     exon            1021..1108
                     /gene="Pnck"
                     /gene_synonym="Camk1b"
                     /inference="alignment:Splign:2.1.0"
     exon            1109..1253
                     /gene="Pnck"
                     /gene_synonym="Camk1b"
                     /inference="alignment:Splign:2.1.0"
     exon            1254..1619
                     /gene="Pnck"
                     /gene_synonym="Camk1b"
                     /inference="alignment:Splign:2.1.0"
ORIGIN      
aaggcatcttagctccgcagcccaccaccctcacacacacctgtgacgcccggcgcgcccccctgcccgcacgcgcacagcccacgcagctctggacacaggcggctgaggttgcggagtccccccacgctgaggcgccaggggccaagcagcgattagggggctgcgtgggtggctgtggtcgtgacaggtggctgcaagcagggtcgcagacatgctgctgctcaagaaacagacggaggacatcagcagtgtctatgagatccgggagaagctgggctcgggtgccttctctgaggtgatgctggcccaggaaaggggctctgctcatcttgtggccctcaagtgcattcccaagaaagcacttcggggcaaggaggccctggtggagaatgagatcgcagtactccgcaggattagccaccccaacattgtggctctggaggacgtccacgagagcccttcccatctctacttggccatggagctggtaacaggtggtgaactgtttgaccgaatcatggagcggggctcctacacagagaaggatgcgagccaccttgtagggcaggtccttggtgctgtctcctaccttcatagcctgggcatcgtgcaccgggacctcaagcctgaaaacctcctctatgccacaccttttgaggactccaagatcatggtctctgactttggcctgtccaaaattcaagctggcaacatgctaggcacagcctgtgggaccccaggatatgtggccccagagctcctggagcagaaaccctacgggaaggccgtagatgtgtgggccctgggtgtcatctcctacatcctgctgtgtgggtacccccccttctatgatgagagcgatcctgaactcttcagccagattctgagggccagctacgagtttgactctcccttttgggatgacatctcagaatcagccaaagacttcattcggcaccttctggaacgtgatccccagaagaggttcacctgccaacaggccttacagcatctctggatctctggggatgcagccttggacagggacatcctaggttctgtcagtgagcagatccagaagaattttgccaggacccactggaagcgtgcattcaatgccacatcattcctacgtcacatccgtaagctgggacagagcccagagggtgaggaggcctccaggcagggtatgacccgtcacagccacccaggccttgggactagccagtctcccaagtggtgacaaccaggtggatgccaaggaaggccaagtggactgactcctagcttttctttcctccagcccttttgatctccttccctgatccttgtcccccggactggcctctgttggaaagtccaagaccgtgggtgtgatgcatggcactggggtatggggcttcccaagtatgtccccagcctctgtcctttgttgctgccaccctctatggaaactgaggaggtattcaaaaatggatttgggggccatccttcctgcaccttgcacgcacatatgcattgcgtggctgttctgtgctttgctgactgtgggtggtcctgcttgtgttgtagccctttagttcctcctctttccaaccaataaagacaaacagaac
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]