2024-03-29 08:40:22, GGRNA.v2 : RefSeq release 222 (Jan, 2024)
LOCUS NM_017149 2247 bp mRNA linear ROD 20-MAR-2023 DEFINITION Rattus norvegicus mesenchyme homeobox 2 (Meox2), mRNA. ACCESSION NM_017149 VERSION NM_017149.2 KEYWORDS RefSeq; RefSeq Select. SOURCE Rattus norvegicus (Norway rat) ORGANISM Rattus norvegicus Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha; Muroidea; Muridae; Murinae; Rattus. REFERENCE 1 (bases 1 to 2247) AUTHORS Shi H, Duan L, Lan Y, He Q, Pu P and Tang H. TITLE RING Finger Protein 10 Regulates AP-1/Meox2 to Mediate Pirarubicin-Induced Cardiomyocyte Apoptosis JOURNAL Oxid Med Cell Longev 2023, 7872193 (2023) PUBMED 36713029 REMARK GeneRIF: RING Finger Protein 10 Regulates AP-1/Meox2 to Mediate Pirarubicin-Induced Cardiomyocyte Apoptosis. Publication Status: Online-Only REFERENCE 2 (bases 1 to 2247) AUTHORS Liu P, Feng J, Kong F, Lu Q, Xu H, Meng J and Jiang Y. TITLE Gax inhibits perivascular preadipocyte biofunction mediated by IGF-1 induced FAK/Pyk2 and ERK2 cooperative pathways JOURNAL Cell Signal 26 (12), 3036-3045 (2014) PUBMED 25280940 REMARK GeneRIF: The present study was designed to investigate whether FAK/Pyk2 and ERK1/2 MAPK signaling pathways participate in Perivascular adipocyte functions, which is activated by insulin-like growth factor 1(IGF-1) and inhibited by Gax. REFERENCE 3 (bases 1 to 2247) AUTHORS Cunnington RH, Northcott JM, Ghavami S, Filomeno KL, Jahan F, Kavosh MS, Davies JJ, Wigle JT and Dixon IM. TITLE The Ski-Zeb2-Meox2 pathway provides a novel mechanism for regulation of the cardiac myofibroblast phenotype JOURNAL J Cell Sci 127 (Pt 1), 40-49 (2014) PUBMED 24155330 REMARK GeneRIF: Ski modulates the cardiac myofibroblast phenotype and function through suppression of Zeb2 by upregulating the expression of Meox2. REFERENCE 4 (bases 1 to 2247) AUTHORS Rovelet-Lecrux A, Legallic S, Wallon D, Flaman JM, Martinaud O, Bombois S, Rollin-Sillaire A, Michon A, Le Ber I, Pariente J, Puel M, Paquet C, Croisile B, Thomas-Anterion C, Vercelletto M, Levy R, Frebourg T, Hannequin D and Campion D. CONSRTM Investigators of the GMAJ project TITLE A genome-wide study reveals rare CNVs exclusive to extreme phenotypes of Alzheimer disease JOURNAL Eur J Hum Genet 20 (6), 613-617 (2012) PUBMED 22166940 REFERENCE 5 (bases 1 to 2247) AUTHORS Douville JM, Cheung DY, Herbert KL, Moffatt T and Wigle JT. TITLE Mechanisms of MEOX1 and MEOX2 regulation of the cyclin dependent kinase inhibitors p21 and p16 in vascular endothelial cells JOURNAL PLoS One 6 (12), e29099 (2011) PUBMED 22206000 REFERENCE 6 (bases 1 to 2247) AUTHORS Saito T, Itoh H, Yamashita J, Doi K, Chun TH, Tanaka T, Inoue M, Masatsugu K, Fukunaga Y, Sawada N, Sakaguchi S, Arai H, Tojo K, Tajima N, Hosoya T and Nakao K. TITLE Angiotensin II suppresses growth arrest specific homeobox (Gax) expression via redox-sensitive mitogen-activated protein kinase (MAPK) JOURNAL Regul Pept 127 (1-3), 159-167 (2005) PUBMED 15680482 REMARK GeneRIF: demonstrated that Ang II down-regulated Gax expression via redox-sensitive ERK1/2 activation in vascular smooth muscle cells [Gax] REFERENCE 7 (bases 1 to 2247) AUTHORS Mankoo BS, Skuntz S, Harrigan I, Grigorieva E, Candia A, Wright CV, Arnheiter H and Pachnis V. TITLE The concerted action of Meox homeobox genes is required upstream of genetic pathways essential for the formation, patterning and differentiation of somites JOURNAL Development 130 (19), 4655-4664 (2003) PUBMED 12925591 REFERENCE 8 (bases 1 to 2247) AUTHORS Mankoo BS, Collins NS, Ashby P, Grigorieva E, Pevny LH, Candia A, Wright CV, Rigby PW and Pachnis V. TITLE Mox2 is a component of the genetic hierarchy controlling limb muscle development JOURNAL Nature 400 (6739), 69-73 (1999) PUBMED 10403250 REFERENCE 9 (bases 1 to 2247) AUTHORS Quinn LM, Johnson BV, Nicholl J, Sutherland GR and Kalionis B. TITLE Isolation and identification of homeobox genes from the human placenta including a novel member of the Distal-less family, DLX4 JOURNAL Gene 187 (1), 55-61 (1997) PUBMED 9073066 REFERENCE 10 (bases 1 to 2247) AUTHORS Gorski DH, LePage DF, Patel CV, Copeland NG, Jenkins NA and Walsh K. TITLE Molecular cloning of a diverged homeobox gene that is rapidly down-regulated during the G0/G1 transition in vascular smooth muscle cells JOURNAL Mol Cell Biol 13 (6), 3722-3733 (1993) PUBMED 8098844 COMMENT PROVISIONAL REFSEQ: This record has not yet been subject to final NCBI review. The reference sequence was derived from JACYVU010000164.1. On Nov 26, 2020 this sequence version replaced NM_017149.1. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## Transcript exon combination :: Z17223.1 [ECO:0000332] RNAseq introns :: single sample supports all introns SAMEA5756307, SAMEA5760384 [ECO:0000348] ##Evidence-Data-END## ##RefSeq-Attributes-START## RefSeq Select criteria :: based on single protein-coding transcript ##RefSeq-Attributes-END## PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP 1-706 JACYVU010000164.1 30144923-30145628 707-879 JACYVU010000164.1 30194590-30194762 880-2247 JACYVU010000164.1 30204263-30205630 FEATURES Location/Qualifiers source 1..2247 /organism="Rattus norvegicus" /mol_type="mRNA" /strain="BN" /db_xref="taxon:10116" /chromosome="6" /map="6q21" gene 1..2247 /gene="Meox2" /note="mesenchyme homeobox 2" /db_xref="GeneID:29279" /db_xref="RGD:3079" exon 1..706 /gene="Meox2" /inference="alignment:Splign:2.1.0" misc_feature 178..180 /gene="Meox2" /note="upstream in-frame stop codon" CDS 193..1104 /gene="Meox2" /note="growth arrest-specific homeobox; mesenchyme homeo box 2 (growth arrest-specific homeo box)" /codon_start=1 /product="homeobox protein MOX-2" /protein_id="NP_058845.2" /db_xref="GeneID:29279" /db_xref="RGD:3079" /translation="
MEHPLFGCLRSPHATAQGLHPFSQSSLALHGRSDHMSYPELSTSSSSCIIAGYPNEEGMFASQHHRGHHHHHHHHHHHHQQQQHQALQSNWHLPQMSSPPSAARHSLCLQPDSGGPPELGSSPPVLCSNSSSLGSSTPTGAACAPGDYGRQALSPAEVEKRSGSKRKSDSSDSQEGNYKSEVNSKPRKERTAFTKEQIRELEAEFAHHNYLTRLRRYEIAVNLDLTERQVKVWFQNRRMKWKRVKGGQQGAAAREKELVNVKKGTLLPSELSGIGAATLQQTGDSLANDDSRDSDHSSEHAHL"
misc_feature 379..765 /gene="Meox2" /note="propagated from UniProtKB/Swiss-Prot (P39020.1); Region: Disordered. /evidence=ECO:0000256|SAM:MobiDB-lite" misc_feature order(751..765,769..771,820..822,838..840,877..879, 883..888,895..900,904..912,916..921) /gene="Meox2" /note="DNA binding site [nucleotide binding]" /db_xref="CDD:238039" misc_feature order(757..759,766..768,886..888,895..900,907..909) /gene="Meox2" /note="specific DNA base contacts [nucleotide binding]; other site" /db_xref="CDD:238039" misc_feature 760..918 /gene="Meox2" /note="Homeobox domain; Region: Homeobox; pfam00046" /db_xref="CDD:425441" misc_feature 1027..1101 /gene="Meox2" /note="propagated from UniProtKB/Swiss-Prot (P39020.1); Region: Disordered. /evidence=ECO:0000256|SAM:MobiDB-lite" exon 707..879 /gene="Meox2" /inference="alignment:Splign:2.1.0" exon 880..2247 /gene="Meox2" /inference="alignment:Splign:2.1.0" ORIGIN
agtgtttatacgtgcaggagactggccgctcggctcaggactgggattagcgggctctgctcaaacccgcgcggcttttacattaggagtgagtgggggagagtcctaggatttctagtgaaaagtgacagcgcttggtggactttgggaccttcgtgaagtcttctgcttggaagctgagacttgcatgccatggaacaccccctctttggctgcctgcgcagcccccacgccacagcgcaaggcttgcaccccttctcgcagtcttctctggccctccatggaagatctgaccacatgtcctaccccgaactctccacatcttcctcgtcttgcataatcgcgggataccccaatgaggagggcatgtttgccagccagcatcacagggggcaccaccaccaccaccaccaccaccatcaccaccaccagcagcagcagcaccaggctctgcaaagcaactggcacctcccgcagatgtcctccccgccaagcgcggcccggcacagcctttgcctgcagcctgattccggagggcccccggagctggggagcagccctccggtcctgtgctccaactcttctagcctgggctccagcaccccgaccggagccgcgtgcgcaccaggggattatggccgtcaagcgctgtcacccgcagaagtggagaagagaagtggcagcaaaagaaaaagcgacagttcagattcccaggaaggaaattacaagtcagaagtgaacagcaaacctaggaaggaaagaacagctttcaccaaagagcaaatcagagaacttgaggcagagttcgcccatcataactatctgaccagactgagaagatatgagatagcggtgaacctagacctcactgaaagacaggtgaaagtgtggttccagaacaggagaatgaagtggaagcgggtcaaggggggacaacaaggagctgcagcccgagaaaaggaactggtgaatgtgaaaaagggaacacttcttccatcagagctgtcaggaattggtgcagccaccctccagcagacaggggactcactagcaaatgacgacagtcgcgatagtgaccacagctctgagcacgcacacttatgatacatacagagaccagctccgttctcaggaaagcaccattgtgatggcaaatctcacccaaacatcgtttacatggcagatgactgtggcagtgttgcttaatataattaaacgcaggcatctcaagtctgtttctcatgattgatagaaggtttacactaagtgcctcttattgaagatgcttccacagtgaaattggagaaagtgaacatattctaaatatacttgttcctttatatgacagagagggagatgaatgtttgctttggcttgcactgaaaattaaattgctaccaagagcaaactcggtaagacattttgactcaagttgtctccagagtgaagatgttatagaaatgctttgaacattccagttgtaccaggtcatgtgtgtgacactgggcaggtatttgcttttgcttgcactgaaacttaaactgctatcaagttaacccatgaaatagtttatcttgaacagccacagtgcctgaaatcaccaagtggatataaaatgaactgaaattctgtatatattactcctaagtcattttcctgtcttcactaattttagcaaatgcattcatattagctgatgaaaataggctttcccgtggacaaatgcagccagcttcttgtatttttatacatttttttgtcagtcagagacaatcagtatgtgcttacttgtgttcaagtagaggaaatgcagtagagtctgataggacatattcttgtaccacagacaaaacaaatcttctgttgcattgactatcaactgctgcagatacattagagaacacacctagcccccctccagcctccctctgttatagctcgaagaacattaggatcataggcaagtaggttaccttgccaaatgagtcttgtgtggcagatgtctgattttgtatctttaaactgttaatgtgtatgggtctgcttcagtttaacagggaaaaagatttcttcctcattgtttatgatacaaaacccaagtgccaaacaaagctagttcttcaagggaatagatgagaaactgaatgtctgacaagtagactcagcgaaaatacattatttttcagaggctgtgtattcatgcagtacaagtccttgtattttgtaaaaaaaaaagttaaataaatg
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]