GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2020-04-06 12:14:34, GGRNA.v2 : RefSeq release 99 (Mar, 2020)

LOCUS       NM_001518               4392 bp    mRNA    linear   PRI 13-OCT-2019
DEFINITION  Homo sapiens general transcription factor IIi (GTF2I), transcript
            variant 4, mRNA.
ACCESSION   NM_001518 XM_939506
VERSION     NM_001518.5
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 4392)
  AUTHORS   Meng Y, He Y, Zhang J, Xie Q, Yang M, Chen Y and Wu Y.
  TITLE     Association of GTF2I gene polymorphisms with renal involvement of
            systemic lupus erythematosus in a Chinese population
  JOURNAL   Medicine (Baltimore) 98 (31), e16716 (2019)
   PUBMED   31374066
  REMARK    GeneRIF: A case-control study identified the involvement of GTF2I
            gene polymorphisms in development of systemic lupus erythematosus,
            particularly in renal involvement.
REFERENCE   2  (bases 1 to 4392)
  AUTHORS   Radovich M, Pickering CR, Felau I, Ha G, Zhang H, Jo H, Hoadley KA,
            Anur P, Zhang J, McLellan M, Bowlby R, Matthew T, Danilova L, Hegde
            AM, Kim J, Leiserson MDM, Sethi G, Lu C, Ryan M, Su X, Cherniack
            AD, Robertson G, Akbani R, Spellman P, Weinstein JN, Hayes DN,
            Raphael B, Lichtenberg T, Leraas K, Zenklusen JC, Fujimoto J,
            Scapulatempo-Neto C, Moreira AL, Hwang D, Huang J, Marino M, Korst
            R, Giaccone G, Gokmen-Polar Y, Badve S, Rajan A, Strobel P, Girard
            N, Tsao MS, Marx A, Tsao AS and Loehrer PJ.
  CONSRTM   Cancer Genome Atlas Network
  TITLE     The Integrated Genomic Landscape of Thymic Epithelial Tumors
  JOURNAL   Cancer Cell 33 (2), 244-258 (2018)
   PUBMED   29438696
  REMARK    GeneRIF: demonstrate a marked prevalence of a thymoma-specific
            mutated oncogene, GTF2I
REFERENCE   3  (bases 1 to 4392)
  AUTHORS   Roy AL.
  TITLE     Biochemistry and biology of the inducible multifunctional
            transcription factor TFII-I: 10 years later
  JOURNAL   Gene 492 (1), 32-41 (2012)
   PUBMED   22037610
  REMARK    Review article
REFERENCE   4  (bases 1 to 4392)
  AUTHORS   Makeyev AV and Bayarsaihan D.
  TITLE     Alternative splicing and promoter use in TFII-I genes
  JOURNAL   Gene 433 (1-2), 16-25 (2009)
   PUBMED   19111598
  REMARK    GeneRIF: analyzed promoter regions of TFII-I genes and described
            their additional exons, as well as tested tissue specificity of
            both previously reported and novel alternatively spliced isoforms
REFERENCE   5  (bases 1 to 4392)
  AUTHORS   Cheriyath V and Roy AL.
  TITLE     Alternatively spliced isoforms of TFII-I. Complex formation,
            nuclear translocation, and differential gene regulation
  JOURNAL   J. Biol. Chem. 275 (34), 26300-26308 (2000)
   PUBMED   10854432
REFERENCE   6  (bases 1 to 4392)
  AUTHORS   Roy AL, Du H, Gregor PD, Novina CD, Martinez E and Roeder RG.
  TITLE     Cloning of an inr- and E-box-binding protein, TFII-I, that
            interacts physically and functionally with USF1
  JOURNAL   EMBO J. 16 (23), 7091-7104 (1997)
   PUBMED   9384587
REFERENCE   7  (bases 1 to 4392)
  AUTHORS   Grueneberg DA, Henry RW, Brauer A, Novina CD, Cheriyath V, Roy AL
            and Gilman M.
  TITLE     A multifunctional DNA-binding protein that promotes the formation
            of serum response factor/homeodomain complexes: identity to TFII-I
  JOURNAL   Genes Dev. 11 (19), 2482-2493 (1997)
   PUBMED   9334314
REFERENCE   8  (bases 1 to 4392)
  AUTHORS   Yang W and Desiderio S.
  TITLE     BAP-135, a target for Bruton's tyrosine kinase in response to B
            cell receptor engagement
  JOURNAL   Proc. Natl. Acad. Sci. U.S.A. 94 (2), 604-609 (1997)
   PUBMED   9012831
REFERENCE   9  (bases 1 to 4392)
  AUTHORS   Roy AL, Carruthers C, Gutjahr T and Roeder RG.
  TITLE     Direct role for Myc in transcription initiation mediated by
            interactions with TFII-I
  JOURNAL   Nature 365 (6444), 359-361 (1993)
   PUBMED   8377829
REFERENCE   10 (bases 1 to 4392)
  AUTHORS   Roy AL, Meisterernst M, Pognonec P and Roeder RG.
  TITLE     Cooperative interaction of an initiator-binding transcription
            initiation factor and the helix-loop-helix activator USF
  JOURNAL   Nature 354 (6350), 245-248 (1991)
   PUBMED   1961251
COMMENT     REVIEWED REFSEQ: This record has been curated by NCBI staff. The
            reference sequence was derived from AK292832.1, BC070484.1,
            CB118501.1, AF035737.1, BC099907.1 and AA641906.1.
            On Jun 2, 2019 this sequence version replaced NM_001518.4.
            
            Summary: This gene encodes a phosphoprotein containing six
            characteristic repeat motifs. The encoded protein binds to the
            initiator element (Inr) and E-box element in promoters and
            functions as a regulator of transcription. This locus, along with
            several other neighboring genes, is deleted in Williams-Beuren
            syndrome. There are many closely related genes and pseudogenes for
            this gene on chromosome 7. This gene also has pseudogenes on
            chromosomes 9, 13, and 21. Alternatively spliced transcript
            variants encoding multiple isoforms have been observed. [provided
            by RefSeq, Jul 2013].
            
            Transcript Variant: This variant (4) lacks two alternate in-frame
            exons, compared to variant 1. The encoded isoform (4, also known as
            delta) is shorter than isoform 1.
            
            Publication Note:  This RefSeq record includes a subset of the
            publications that are available for this gene. Please see the Gene
            record to access additional publications.
            
            ##Evidence-Data-START##
            Transcript exon combination :: SRR1803615.75601.1,
                                           SRR1803615.243281.1 [ECO:0000332]
            RNAseq introns              :: single sample supports all introns
                                           SAMEA1965299, SAMEA1966682
                                           [ECO:0000348]
            ##Evidence-Data-END##
            COMPLETENESS: complete on the 3' end.
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-4                 AK292832.1         39-42
            5-2947              BC070484.1         1-2943
            2948-2948           CB118501.1         232-232
            2949-4046           AF035737.1         3032-4129
            4047-4048           BC099907.1         4089-4090
            4049-4392           AA641906.1         13-356              c
FEATURES             Location/Qualifiers
     source          1..4392
                     /organism="Homo sapiens"
                     /mol_type="mRNA"
                     /db_xref="taxon:9606"
                     /chromosome="7"
                     /map="7q11.23"
     gene            1..4392
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /note="general transcription factor IIi"
                     /db_xref="GeneID:2969"
                     /db_xref="HGNC:HGNC:4659"
                     /db_xref="MIM:601679"
     exon            1..351
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /inference="alignment:Splign:2.1.0"
     variation       1..8
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="gagaga"
                     /replace="gagagaga"
                     /db_xref="dbSNP:1400852759"
     variation       3
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1362619630"
     variation       12
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1419538729"
     variation       12
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="t"
                     /replace="tt"
                     /db_xref="dbSNP:1296575506"
     variation       13
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1376416978"
     variation       17
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1178915466"
     variation       18
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1431908110"
     variation       19
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1422477828"
     variation       20
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1190066454"
     variation       21..26
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="a"
                     /replace="agagaa"
                     /db_xref="dbSNP:1477947559"
     variation       22
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1264968726"
     variation       24
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1213990963"
     variation       33
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1487868400"
     variation       34
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1256338454"
     variation       35
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1212177883"
     variation       37..38
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="cg"
                     /replace="cgcg"
                     /db_xref="dbSNP:782496141"
     variation       38
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1278009533"
     variation       43..49
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="cccccc"
                     /replace="ccccccc"
                     /replace="cccccccc"
                     /db_xref="dbSNP:1219396231"
     variation       43
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1276594465"
     variation       44
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1399595365"
     variation       49
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1304911206"
     variation       50
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1464999394"
     variation       53
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1554384303"
     variation       68
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1554384308"
     variation       73
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1554384312"
     variation       76
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1359028300"
     variation       77
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1171728494"
     variation       79
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1465742902"
     variation       80..97
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="c"
                     /replace="cgcccgcctgccgcggtc"
                     /db_xref="dbSNP:1425125361"
     variation       80
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1191116825"
     variation       84
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1477262619"
     variation       86
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1256609537"
     variation       89
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1482150256"
     variation       100
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1236889237"
     variation       104
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1199165585"
     variation       106
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:587732315"
     variation       111
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1256189540"
     variation       113
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1218278361"
     variation       118
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1554384334"
     variation       119
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:146380720"
     variation       120
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1394727334"
     variation       125
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1554384344"
     variation       137
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:587715197"
     variation       149
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1449615578"
     variation       150
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1401886348"
     variation       151..153
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="cc"
                     /replace="ccc"
                     /db_xref="dbSNP:1167843471"
     variation       155
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1461176758"
     variation       156
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1368749219"
     variation       159
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1554384357"
     variation       162
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1166451449"
     variation       163
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1554384363"
     variation       165
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:62475396"
     variation       170
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1255175516"
     variation       174
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1179209774"
     variation       177
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1458999761"
     variation       185
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1236451414"
     variation       191
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1198020814"
     variation       200
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1488848288"
     variation       204
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1267518947"
     variation       214..218
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="cccc"
                     /replace="ccccc"
                     /db_xref="dbSNP:1242854489"
     variation       216
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1554384385"
     variation       217
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1321539637"
     variation       220..240
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="ctcgcc"
                     /replace="ctcgcctcccgtccgctcgcc"
                     /db_xref="dbSNP:1310403410"
     variation       225
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1242966681"
     variation       227
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1554384396"
     variation       229
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1554384401"
     variation       230
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1375240812"
     variation       231
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1390373894"
     variation       237
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1390793944"
     variation       242
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1554384412"
     variation       243
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1294963717"
     variation       246
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1384399958"
     variation       247
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1158968028"
     variation       248
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1441474304"
     variation       253
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1378481307"
     variation       255
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1177922460"
     variation       257
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1433893962"
     variation       263
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1269521047"
     variation       264
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1562927602"
     variation       267
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1208321179"
     variation       268
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1488251829"
     variation       271
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1287195997"
     variation       279
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1219332040"
     variation       285
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1351943177"
     variation       286
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:950832251"
     variation       290..305
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="cccacactcgcctccc"
                     /replace="cccacactcgcctcccacactcgcctccc"
                     /db_xref="dbSNP:1554384441"
     variation       291
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1554384445"
     variation       300
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1309230654"
     variation       303
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1554384448"
     variation       304
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1234559015"
     variation       307
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1331209096"
     variation       309
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1302695724"
     variation       310
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1364498397"
     variation       314
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1298432625"
     variation       318
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:983416808"
     variation       320
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:587750004"
     variation       322
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1157967793"
     variation       325
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1554384470"
     variation       330
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:587647789"
     variation       331
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:971425810"
     variation       341
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:980337812"
     exon            352..455
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /inference="alignment:Splign:2.1.0"
     CDS             357..3230
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /note="isoform 4 is encoded by transcript variant 4;
                     BTK-associated protein, 135kD; Bruton tyrosine
                     kinase-associated protein 135; general transcription
                     factor II-I; SRF-Phox1-interacting protein;
                     Williams-Beuren syndrome chromosome region 6"
                     /codon_start=1
                     /product="general transcription factor II-I isoform 4"
                     /protein_id="NP_001509.3"
                     /db_xref="CCDS:CCDS47614.1"
                     /db_xref="GeneID:2969"
                     /db_xref="HGNC:HGNC:4659"
                     /db_xref="MIM:601679"
                     /translation="
MAQVAMSTLPVEDEESSESRMVVTFLMSALESMCKELAKSKAEVACIAVYETDVFVVGTERGRAFVNTRKDFQKDFVKYCVEEEEKAAEMHKMKSTTQANRMSVDAVEIETLRKTVEDYFCFCYGKALGKSTVVPVPYEKMLRDQSAVVVQGLPEGVAFKHPENYDLATLKWILENKAGISFIIKRPFLEPKKHVGGRVMVTDADRSILSPGGSCGPIKVKTEPTEDSGISLEMAAVTVKEESEDPDYYQYNIQGSHHSSEGNEGTEMEVPAEDDDYSPPSKRPKANELPQPPVPEPANAGKRKVREFNFEKWNARITDLRKQVEELFERKYAQAIKAKGPVTIPYPLFQSHVEDLYVEGLPEGIPFRRPSTYGIPRLERILLAKERIRFVIKKHELLNSTREDLQLDKPASGVKEEWYARITKLRKMVDQLFCKKFAEALGSTEAKAVPYQKFEAHPNDLYVEGLPENIPFRSPSWYGIPRLEKIIQVGNRIKFVIKRPELLTHSTTEVTQPRTNTPVKEDWNVRITKLRKQVEEIFNLKFAQALGLTEAVKVPYPVFESNPEFLYVEGLPEGIPFRSPTWFGIPRLERIVRGSNKIKFVVKKPELVISYLPPGMASKINTKALQSPKRPRSPGSNSKVPEIEVTVEGPNNNNPQTSAVRTPTQTNGSNVPFKPRGREFSFEAWNAKITDLKQKVENLFNEKCGEALGLKQAVKVPFALFESFPEDFYVEGLPEGVPFRRPSTFGIPRLEKILRNKAKIKFIIKKPEMFETAIKESTSSKSPPRKINSSPNVNTTASGVEDLNIIQVTIPDDDNERLSKVEKARQLREQVNDLFSRKFGEAIGMGFPVKVPYRKITINPGCVVVDGMPPGVSFKAPSYLEISSMRRILDSAEFIKFTVIRPFPGLVINNQLVDQSESEGPVIQESAEPSQLEVPATEEIKETDGSSQIKQEPDPTW"
     misc_feature    690..908
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /note="GTF2I-like repeat; Region: GTF2I; pfam02946"
                     /db_xref="CDD:308544"
     misc_feature    1314..1532
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /note="GTF2I-like repeat; Region: GTF2I; pfam02946"
                     /db_xref="CDD:308544"
     misc_feature    1629..1847
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /note="GTF2I-like repeat; Region: GTF2I; pfam02946"
                     /db_xref="CDD:308544"
     misc_feature    1944..2162
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /note="GTF2I-like repeat; Region: GTF2I; pfam02946"
                     /db_xref="CDD:308544"
     misc_feature    2430..2624
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /note="GTF2I-like repeat; Region: GTF2I; pfam02946"
                     /db_xref="CDD:308544"
     misc_feature    2835..3053
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /note="GTF2I-like repeat; Region: GTF2I; pfam02946"
                     /db_xref="CDD:308544"
     variation       357
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:782164151"
     variation       362
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1554396175"
     variation       367
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1554396182"
     variation       368
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:782493466"
     variation       370
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1437851275"
     variation       372
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1554396193"
     variation       373
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:781807761"
     variation       374
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1554396198"
     variation       378
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1554396201"
     variation       380
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:587651814"
     variation       381
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1554396209"
     variation       383
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:781817779"
     variation       384
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:782767960"
     variation       386
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:142138701"
     variation       387
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:782542929"
     variation       389
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1015616516"
     variation       397
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:971361460"
     variation       398
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1178011726"
     variation       401
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1554396225"
     variation       404
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:782588651"
     variation       406
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:782177453"
     variation       407
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:146689774"
     variation       414
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:373523357"
     variation       417
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:782238246"
     variation       419
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1451194266"
     variation       422
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:139725334"
     variation       425
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1186001613"
     variation       428
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:551805526"
     variation       431
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:782019694"
     variation       432
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1554396243"
     variation       435
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1554396246"
     variation       436
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:782199279"
     variation       446
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:377650658"
     variation       452
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:781965765"
     variation       454
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1554396253"
     exon            456..594
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /inference="alignment:Splign:2.1.0"
     variation       470
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1554396873"
     variation       476
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:868927775"
     variation       477
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:587739841"
     variation       478
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:782225301"
     variation       481
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:201580003"
     variation       482
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:182296203"
     variation       495
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1554396888"
     variation       500
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1554396891"
     variation       503
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:144420417"
     variation       509
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:782438203"
     variation       514
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:782022638"
     variation       515
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:782075554"
     variation       516
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:368759932"
     variation       518
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1554396910"
     variation       521
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:979904437"
     variation       522
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1261533732"
     variation       524
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1193370028"
     variation       525
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1486175636"
     variation       526
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1283124989"
     variation       527
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:369679525"
     variation       543
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:924091625"
     variation       544
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:781967568"
     variation       552
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1309950856"
     variation       555
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:782088030"
     variation       556
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1562952944"
     variation       566
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:146598910"
     variation       575
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:143931854"
     variation       588
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:782142169"
     variation       589
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1554396930"
     variation       590
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:976119267"
     exon            595..729
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /inference="alignment:Splign:2.1.0"
     variation       597
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:200063075"
     variation       600..611
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="gaagaa"
                     /replace="gaagaagaa"
                     /replace="gaagaagaagaa"
                     /db_xref="dbSNP:782754367"
     variation       604
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1245840914"
     variation       611
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:782328272"
     variation       625
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1323681403"
     variation       627
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:868917188"
     variation       633
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1554399155"
     variation       640
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1554399160"
     variation       641
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:782585870"
     variation       642
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:782230656"
     variation       645
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1554399163"
     variation       647
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:782345125"
     variation       654
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1554399167"
     variation       657
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:782003787"
     variation       658
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:782120808"
     variation       664
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1445142239"
     variation       665
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1397502344"
     variation       666
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:906057032"
     variation       669
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:782413639"
     variation       672
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1458112170"
     variation       674
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:781931714"
     variation       678
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1053566327"
     variation       681
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1369813298"
     variation       692
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1162479006"
     variation       701
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1554399193"
     variation       707
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:782049177"
     variation       711
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:782737598"
     variation       712
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:150259949"
     variation       713
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1554399206"
     variation       719
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1554399208"
     variation       721
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1554399211"
     variation       728
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1180444014"
     exon            730..913
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /inference="alignment:Splign:2.1.0"
     variation       731
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:781983673"
     variation       734
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1554399485"
     variation       740
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:782799288"
     variation       748
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:781795612"
     variation       752
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:781943013"
     variation       753
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:782057203"
     variation       756
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1378271459"
     variation       761
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:782745853"
     variation       767
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:781823900"
     variation       780
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1049009087"
     variation       782
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:782514449"
     variation       783
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1064765"
     variation       784
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:145729076"
     variation       791
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:782450205"
     variation       792
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:782228824"
     variation       793
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:782481420"
     variation       794
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:190779878"
     variation       798
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:782411031"
     variation       808
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:782015737"
     variation       812
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1554399520"
     variation       817
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:782204993"
     variation       818
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:368452418"
     variation       827
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:782080046"
     variation       829
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:782793898"
     variation       830
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:781985101"
     variation       839
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1554399537"
     variation       842
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:148927442"
     variation       843
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:587656081"
     variation       845
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:781788087"
     variation       846
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1554399541"
     variation       851
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:782485177"
     variation       855
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1417416844"
     variation       856
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1554399550"
     variation       863
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:782730755"
     variation       873
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:990392390"
     variation       876
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1057896"
     variation       889
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1135648"
     variation       890
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1554399554"
     variation       902
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1249824042"
     variation       905
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1554399561"
     variation       909
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1489561711"
     exon            914..942
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /inference="alignment:Splign:2.1.0"
     variation       915
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1259679158"
     variation       923
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:782141408"
     variation       936
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:782702015"
     variation       937
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1554399641"
     variation       938
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:147069558"
     variation       940
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:782431867"
     exon            943..997
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /inference="alignment:Splign:2.1.0"
     variation       943
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:781936472"
     variation       945
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:373330111"
     variation       948
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1163463075"
     variation       949
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:202085514"
     variation       950
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:781822433"
     variation       953
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1412526422"
     variation       961
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:782134662"
     variation       965
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:138377665"
     variation       966
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:781911148"
     variation       972
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:782580708"
     variation       973
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:781834137"
     variation       975
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:587751698"
     variation       976
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:368674948"
     variation       977
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:782239284"
     variation       983
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:782419130"
     variation       985
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1554401029"
     variation       987
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1554401032"
     variation       990
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:886875869"
     variation       994
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1554401036"
     exon            998..1041
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /inference="alignment:Splign:2.1.0"
     variation       998
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:782739189"
     variation       1005
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1049146200"
     variation       1010
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1554401414"
     variation       1012
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1554401416"
     variation       1016
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1554401418"
     variation       1025
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:782802810"
     variation       1030
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1554401421"
     variation       1031
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:781890601"
     variation       1036
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:782450272"
     variation       1038
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:782564844"
     variation       1039
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1554401426"
     exon            1042..1119
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /inference="alignment:Splign:2.1.0"
     variation       1043
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:782483207"
     variation       1045
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:143885919"
     variation       1048
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1554402418"
     variation       1049
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:267601566"
     variation       1051
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:781878557"
     variation       1052
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:782515162"
     variation       1059
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1554402432"
     variation       1062
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1554402435"
     variation       1064
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:111506941"
     variation       1067
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1388744073"
     variation       1068
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:782675626"
     variation       1079
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:782282178"
     variation       1085
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1554402441"
     variation       1107
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:199687489"
     variation       1108
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1554402445"
     variation       1118
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:782454977"
     exon            1120..1176
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /inference="alignment:Splign:2.1.0"
     variation       1125
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1554403740"
     variation       1128
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1554403742"
     variation       1130
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1554403745"
     variation       1133
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:782735566"
     variation       1141
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:781919341"
     variation       1142
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:374424412"
     variation       1145
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:367846325"
     variation       1151
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:781868862"
     variation       1154
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:782499259"
     variation       1165
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:782819986"
     variation       1167
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1562971347"
     variation       1168..1173
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="cag"
                     /replace="cagcag"
                     /db_xref="dbSNP:1562971353"
     variation       1172..1177
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="aga"
                     /replace="agaaga"
                     /db_xref="dbSNP:782589088"
     exon            1177..1287
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /inference="alignment:Splign:2.1.0"
     variation       1180
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1554406188"
     variation       1185
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1554406191"
     variation       1195
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1554406192"
     variation       1196
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1246879160"
     variation       1225
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1554406198"
     variation       1240
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1195145913"
     variation       1248
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1554406202"
     variation       1251
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1466700180"
     variation       1252
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1251817960"
     exon            1288..1353
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /inference="alignment:Splign:2.1.0"
     variation       1307
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1292448654"
     variation       1314
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1442713074"
     variation       1316
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1554406395"
     variation       1323
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1337735458"
     variation       1352
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1554406401"
     exon            1354..1537
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /inference="alignment:Splign:2.1.0"
     variation       1355
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1554406964"
     variation       1356
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:782443780"
     variation       1366
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:782608384"
     variation       1378
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:782215532"
     variation       1379
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:782389010"
     variation       1384
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:782631790"
     variation       1385
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:587731802"
     variation       1391
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:148023732"
     variation       1394
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:781941714"
     variation       1395
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:782048314"
     variation       1403
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1554406977"
     variation       1404
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1614448"
     variation       1412
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1369432444"
     variation       1427
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1554406979"
     variation       1433
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1562983465"
     variation       1436
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:782370080"
     variation       1439
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1554406981"
     variation       1463
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:781957319"
     variation       1468
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:782139658"
     variation       1474
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="a"
                     /replace="aa"
                     /db_xref="dbSNP:1404561582"
     variation       1475
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:782769899"
     variation       1488
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1300045468"
     variation       1492
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1417975794"
     variation       1502
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:781886622"
     variation       1517
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1177401114"
     variation       1521
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:782059244"
     variation       1522
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:782683917"
     variation       1535
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1562983524"
     variation       1536..1538
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="aa"
                     /replace="aaa"
                     /db_xref="dbSNP:782415428"
     exon            1538..1596
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /inference="alignment:Splign:2.1.0"
     variation       1541
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:782143965"
     variation       1543
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:782319002"
     variation       1545
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1554407201"
     variation       1552
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1135649"
     variation       1553
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:367969358"
     variation       1554
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:782742467"
     variation       1557
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1554407205"
     variation       1560
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:587719538"
     variation       1561
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:782113008"
     variation       1583
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1554407207"
     variation       1589
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:782812277"
     exon            1597..1668
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /inference="alignment:Splign:2.1.0"
     variation       1616
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1399343107"
     variation       1624
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1554407395"
     variation       1625
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:587657724"
     variation       1631..1638
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="aaga"
                     /replace="aagaaaga"
                     /db_xref="dbSNP:781950092"
     exon            1669..1852
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /inference="alignment:Splign:2.1.0"
     variation       1815
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1554407468"
     variation       1828
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1472417767"
     exon            1853..1911
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /inference="alignment:Splign:2.1.0"
     variation       1863
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:587761904"
     variation       1864
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:781923720"
     variation       1869
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:782103148"
     variation       1870
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:782735877"
     variation       1871
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:781875289"
     variation       1874
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1554407672"
     variation       1878
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1554407674"
     variation       1879
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:782521291"
     variation       1887
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1554407677"
     variation       1890
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:141809495"
     variation       1892
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:781797507"
     variation       1895
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:782429305"
     variation       1899..1906
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="ac"
                     /replace="acgaatac"
                     /db_xref="dbSNP:1554407685"
     variation       1900
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:782615736"
     variation       1901
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:782208267"
     variation       1905
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:782516515"
     variation       1908
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:782637508"
     variation       1910
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:782290322"
     exon            1912..1983
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /inference="alignment:Splign:2.1.0"
     variation       1915
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1439328322"
     variation       1927
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1270640072"
     variation       1939
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1554408523"
     variation       1947
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1554408524"
     variation       1948
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:782552411"
     variation       1952
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1357365397"
     variation       1961
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1554408529"
     variation       1963
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace=""
                     /replace="a"
                     /db_xref="dbSNP:1295155309"
     variation       1966..1970
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="tttt"
                     /replace="ttttt"
                     /db_xref="dbSNP:1231508034"
     variation       1981
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1354973364"
     exon            1984..2167
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /inference="alignment:Splign:2.1.0"
     variation       1992
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200729390"
     variation       1994
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1554408822"
     variation       2000
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1554408823"
     variation       2003
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1554408824"
     variation       2018
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1554408827"
     variation       2020
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1554408829"
     variation       2022
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1554408832"
     variation       2025
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1554408833"
     variation       2043
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1554408835"
     variation       2044
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1554408837"
     variation       2045
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:781805029"
     variation       2054
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:201985028"
     variation       2057
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:879970250"
     variation       2066
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1554408841"
     variation       2073
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1554408844"
     variation       2075..2078
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="ggg"
                     /replace="gggg"
                     /db_xref="dbSNP:781854840"
     variation       2075
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:782629129"
     variation       2078
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1554408852"
     variation       2082
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:782219254"
     variation       2084
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:782398304"
     variation       2087
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:782638478"
     variation       2088
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1554408856"
     variation       2089
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:782305536"
     variation       2093
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1554408858"
     variation       2098
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:782412315"
     variation       2113
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1554408861"
     variation       2114
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:587613537"
     variation       2115
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1554408866"
     variation       2116
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1554408868"
     variation       2120
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:782089310"
     variation       2128
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:782334160"
     variation       2129
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:587717611"
     variation       2130
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:139477988"
     variation       2133
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:587647930"
     variation       2134
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1554408877"
     variation       2135
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:781890941"
     variation       2136
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:782067111"
     variation       2139
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:782708791"
     variation       2156
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:781836896"
     variation       2157
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1554408879"
     variation       2159
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:782485484"
     variation       2163..2168
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="aaaaa"
                     /replace="aaaaaa"
                     /db_xref="dbSNP:1554408881"
     exon            2168..2226
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /inference="alignment:Splign:2.1.0"
     variation       2169
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:782339150"
     variation       2173
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:782253272"
     variation       2177
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1554409025"
     variation       2181
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1554409026"
     variation       2186
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1554409028"
     variation       2187
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1554409030"
     variation       2188
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1554409033"
     variation       2195
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:587720800"
     variation       2197
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:587597791"
     variation       2200
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:782031290"
     variation       2201
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:782278849"
     variation       2202..2203
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace=""
                     /replace="c"
                     /db_xref="dbSNP:1554409039"
     variation       2205
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1554409041"
     variation       2221
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1330426057"
     variation       2223
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1554409043"
     variation       2224
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:782325579"
     exon            2227..2301
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /inference="alignment:Splign:2.1.0"
     variation       2251
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1554409118"
     variation       2295
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1250627760"
     exon            2302..2403
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /inference="alignment:Splign:2.1.0"
     variation       2306..2311
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="taataa"
                     /replace="taataataa"
                     /db_xref="dbSNP:782320436"
     variation       2306
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:782523510"
     variation       2311
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:782621842"
     variation       2315
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1554409418"
     variation       2327
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1554409423"
     variation       2338
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1221518361"
     variation       2340
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1488726890"
     variation       2341
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1554409427"
     variation       2344
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1554409431"
     variation       2345
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1262774852"
     variation       2353
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200224470"
     variation       2357
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:782526066"
     variation       2358
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1554409438"
     variation       2366
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:782584310"
     variation       2367
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1344216605"
     variation       2382
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1401055646"
     variation       2387
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1554409444"
     variation       2399
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1385222677"
     exon            2404..2469
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /inference="alignment:Splign:2.1.0"
     variation       2406
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1411232624"
     variation       2421
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1199881888"
     variation       2426
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1481299286"
     exon            2470..2653
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /inference="alignment:Splign:2.1.0"
     variation       2507
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1244226537"
     variation       2510
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1206157717"
     variation       2511
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1322085555"
     variation       2531
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1255748914"
     variation       2538..2541
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="tttt"
                     /replace="ttttt"
                     /db_xref="dbSNP:1554409605"
     variation       2542
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1228687461"
     variation       2570
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1554409606"
     variation       2584
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1307717022"
     variation       2585
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1554409608"
     variation       2599
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1554409610"
     variation       2600
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1297286691"
     variation       2603
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1432193711"
     variation       2636
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1554409615"
     variation       2639
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1554409617"
     variation       2646
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1363861905"
     exon            2654..2709
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /inference="alignment:Splign:2.1.0"
     variation       2668
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1554409943"
     variation       2671
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1554409946"
     variation       2672
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1554409947"
     variation       2674
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1554409948"
     variation       2683
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace=""
                     /replace="a"
                     /db_xref="dbSNP:1554409950"
     variation       2686
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1554409953"
     exon            2710..2790
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /inference="alignment:Splign:2.1.0"
     variation       2715
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1232358974"
     variation       2723
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1222487091"
     variation       2728
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1554410010"
     variation       2730
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1323958246"
     variation       2731
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:781951551"
     variation       2749
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:782261089"
     variation       2751
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:782382396"
     variation       2762
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:782036223"
     variation       2781
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:782149583"
     variation       2790
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1554410018"
     exon            2791..2874
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /inference="alignment:Splign:2.1.0"
     variation       2796
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:782601028"
     variation       2808..2812
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="ctc"
                     /replace="ctctc"
                     /db_xref="dbSNP:587757380"
     variation       2812
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:782184501"
     variation       2813
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:782338119"
     variation       2818
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1554410253"
     variation       2819
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1354497249"
     variation       2831
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1554410256"
     variation       2832
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1554410257"
     variation       2837
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1298180011"
     variation       2844
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1443752038"
     variation       2848
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:781998365"
     variation       2850..2871
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="aat"
                     /replace="aatgacctctttagtcggaaat"
                     /db_xref="dbSNP:1352639053"
     variation       2855
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:373607978"
     variation       2859
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1554410265"
     variation       2861
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1405926386"
     variation       2864
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1554410271"
     variation       2865
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:782419989"
     variation       2866
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:782012327"
     variation       2867
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:782063789"
     variation       2872
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:782688212"
     exon            2875..3058
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /inference="alignment:Splign:2.1.0"
     variation       2928
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1353189544"
     variation       2945
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1258966505"
     variation       2948
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200523538"
     variation       2966
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1238434155"
     exon            3059..3087
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /inference="alignment:Splign:2.1.0"
     variation       3071
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1554410682"
     exon            3088..3129
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /inference="alignment:Splign:2.1.0"
     variation       3090
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1554410761"
     variation       3091
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1377780079"
     variation       3093
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1554410763"
     variation       3096
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1279686438"
     variation       3103
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1554410765"
     variation       3107
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1554410766"
     variation       3108
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1554410769"
     variation       3109
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:373687583"
     variation       3115
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1554410770"
     variation       3116
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:782368833"
     variation       3119
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:782678044"
     variation       3120
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:782277108"
     exon            3130..3171
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /inference="alignment:Splign:2.1.0"
     variation       3134
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1457130697"
     variation       3141..3142
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="cc"
                     /replace="ccc"
                     /db_xref="dbSNP:1253446476"
     variation       3142
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1554410915"
     variation       3157
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:113065632"
     variation       3158
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1554410918"
     variation       3160
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1554410921"
     variation       3163
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1554410923"
     variation       3171
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:782593847"
     exon            3172..3247
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /inference="alignment:Splign:2.1.0"
     variation       3172
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1253960859"
     variation       3176
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1554411118"
     variation       3183
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1209186099"
     variation       3186
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1554411119"
     variation       3187
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1554411122"
     variation       3188
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:587744125"
     variation       3192
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1554411125"
     variation       3201
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1554411127"
     variation       3209
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1554411131"
     variation       3218..3221
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="cccc"
                     /replace="ccccc"
                     /db_xref="dbSNP:1554411133"
     variation       3219
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1554411135"
     variation       3220
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1260199641"
     variation       3221
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1217086803"
     variation       3223
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1339916973"
     variation       3224
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1554411140"
     variation       3232
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1313615746"
     variation       3235
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1554411145"
     variation       3238
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1554411146"
     variation       3239
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1377638765"
     variation       3243
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:142626199"
     variation       3244
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:2069301"
     variation       3246
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1554411150"
     exon            3248..4392
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /inference="alignment:Splign:2.1.0"
     variation       3279
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1554411274"
     variation       3280
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1554411277"
     variation       3316
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1554411278"
     variation       3481..3483
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace=""
                     /replace="cag"
                     /db_xref="dbSNP:1554411280"
     variation       3525
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:200903481"
     variation       3545
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1554411285"
     variation       3660..3670
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="aaaaaaaaaaa"
                     /replace="aaaaaaaaaaaa"
                     /db_xref="dbSNP:781993986"
     variation       3795
                     /gene="GTF2I"
                     /gene_synonym="BAP135; BTKAP1; DIWS; GTFII-I; IB291; SPIN;
                     TFII-I; WBS; WBSCR6"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1554411286"
ORIGIN      
gagagagaagctgggagagcagagaaaaggggccaccggtcgcccccccgcttccccgcacgcgctctccagccgcggccgcccgcctgccgcggtcaccccggcctctgcctctgtcccccagtgatcggatcaaggcgctgagcgaggccctgcctgcggggcggccatgcggcggtgacaggagcgcgaccgacacgcacgggcccctcgccccctctcgcctcccgtccgctcgccagctcccctcagccgaggctgctccgcggcggccgcagcccgcgcgcggcccacactcgcctcccctcggcacccccggccccggagctgcctggaggcggccgcactcggggatcatggcccaagttgcaatgtccaccctccccgttgaagatgaggagtcctcggagagcaggatggtggtgacattcctcatgtcagctctcgagtccatgtgtaaagaactggccaagtccaaagccgaagtggcctgcattgcagtgtatgaaacagacgtgtttgtcgtcggaactgaaagaggacgtgcttttgtcaataccagaaaggattttcaaaaagattttgtaaaatattgtgttgaagaagaagaaaaagctgcagagatgcataaaatgaaatctacaacccaggcaaatcggatgagtgtagatgctgtagaaattgaaacactcagaaaaacagttgaggactatttctgcttttgctatgggaaagctttaggcaaatccacagtggtacctgtaccatatgagaagatgctgcgagaccagtcggctgtggtagtgcaggggcttccggaaggtgttgcctttaaacaccccgagaactatgatcttgcaaccctgaaatggattttggagaacaaagcagggatttcattcatcattaagagaccttttttagagccaaagaagcatgtaggtggtcgtgtgatggtaacagatgctgacaggtcaatactatctccaggtggaagttgtggccccatcaaagtgaaaactgaacccacagaagattctggcatttccctggaaatggcagctgtgacagtaaaggaagaatcagaagatcctgattattatcaatataacattcaaggaagccaccattcttcagagggcaatgaaggcacagaaatggaagtaccagcagaagatgatgattattctccaccgtctaagagaccaaaggccaatgagctaccgcagccaccagtcccggaacccgccaatgctgggaagcggaaagtgagggagttcaacttcgagaaatggaatgctcgcatcactgatctacgtaaacaagttgaagaattgtttgaaaggaaatatgctcaagccataaaagccaaaggtccggtgacgatcccgtaccctcttttccagtctcatgttgaagatctttatgtagaaggacttcctgaaggaattccttttagaaggccatctacttacggaattcctcgcctggagaggatattacttgcaaaggaaaggattcgttttgtgattaagaaacatgagcttctgaattcaacacgtgaagatttacagcttgataagccagcttcaggagtaaaggaagaatggtatgccagaatcactaaattaagaaagatggtggatcagcttttctgcaaaaaatttgcggaagccttggggagcactgaagccaaggctgtaccgtaccaaaaatttgaggcacacccgaatgatctgtacgtggaaggactgccagaaaacattcctttccgaagtccctcatggtatggaatcccaaggctggaaaaaatcattcaagtgggcaatcgaattaaatttgttattaaaagaccagaacttctgactcacagtaccactgaagttactcagccaagaacgaatacaccagtcaaagaagattggaatgtcagaattaccaagctacggaagcaagtggaagagatttttaatttgaaatttgctcaagctcttggactcaccgaggcagtaaaagtaccatatcctgtgtttgaatcaaacccggagttcttgtatgtggaaggcttgccagaggggattcccttccgaagccctacctggtttggaattccacgacttgaaaggatcgtccgcgggagtaataaaatcaagttcgttgttaaaaaacctgaactagttatttcctacttgcctcctgggatggctagtaaaataaacactaaagctttgcagtcccccaaaagaccacgaagtcctgggagtaattcaaaggttcctgaaattgaggtcaccgtggaaggccctaataacaacaatcctcaaacctcagctgttcgaaccccgacccagactaacggttctaacgttcccttcaagccacgagggagagagttttcctttgaggcctggaatgccaaaatcacggacctaaaacagaaagttgaaaatctcttcaatgagaaatgtggggaagctcttggccttaaacaagctgtgaaggtgccgttcgcgttatttgagtctttcccggaagacttttatgtggaaggcttacctgagggtgtgccattccgaagaccatcgacttttggcattccgaggctggagaagatactcagaaacaaagccaaaattaagttcatcattaaaaagcccgaaatgtttgagacggcgattaaggagagcacctcctctaagagccctcccagaaaaataaattcatcacccaatgttaatactactgcatcaggtgttgaagaccttaacatcattcaggtgacaattccagatgatgataatgaaagactctcgaaagttgaaaaagctagacagctaagagaacaagtgaatgacctctttagtcggaaatttggtgaagctattggtatgggttttcctgtgaaagttccctacaggaaaatcacaattaaccctggctgtgtggtagttgatggcatgcccccgggggtgtccttcaaagcccccagctacctggaaatcagctccatgagaaggatcttagactctgccgagtttatcaaattcacggtcattagaccatttccaggacttgtgattaataaccagctggttgatcagagtgagtcagaaggccccgtgatacaagaatcagctgaaccaagccagttggaagttccagccacagaagaaataaaagagactgatggaagctctcagatcaagcaagaaccagaccccacgtggtagacctcttccctcctaggcttaaagtatcagtggttgagaagagcttttcggacctgttactaccccaagctgtgtaatatacttgtataacagaaataccttctatacaaacctttttttctacttttagatagaaatgtctactttttcagcagttctgtgaattaaagagcagagtgactgtgggtctggaatggctggtgtacttgggaatgtactatcaggattttacagcaatgctgggaaatgacagggaaaatgacaggaatgaatctcaccagattttttatgtactcagcagagccttgagttacggtgtttattttccaatcaagtgaagatatctcctacttctcctactggaacatctcagcttctgcagtgaagaaaaattcctgtgatagttcagttctttagtttttctatttgaaaaaaaaaaatcatttaaatgatcctttgttcacggctctccttaatgactgagtgaacagttcctatctgtatatttgactaaaccttttcctaagctatctctcatggttcctatgtttttttatcataattaaaagcaaaaccatctggatcacctaacagtcagaggtcagtatctcagcgtgtgaattatagaggaaatacagagagaacctcttccacttttacttttcgtccaaataaaatgcatggtgtaccagaagttgaagatcgggttgaggattggggctagctcgatgacactaaggccccaacatcgcgggacctgctgtggcgcggattcttaggaacgctgttctagccggccccctctccaggggtcgccgtggccggcattatttcctagttcttcttgtaaccctgaggtgccagcgcggggagtgaggaggggtcagggggctaaggatgcaacctctgacgttctgcgccttcctaggagagtcttacatgtgttgagatttcacaagcaatgcgagttgtaaaataccagctctacaagaagctaggctctgtgacggcatagttttcagtagctttatcacaatattcacaatggagaattatatgacatggtagcagaaataggcccttttatgtgttgcttctattttacctcaaattgtagatatagggtaatcaataaaatccatccatgcctttcacacactaa
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]