GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2020-03-31 05:36:14, GGRNA.v2 : RefSeq release 99 (Mar, 2020)

LOCUS       NM_001318744            1479 bp    mRNA    linear   VRT 22-DEC-2019
DEFINITION  Xenopus tropicalis UNC homeobox (uncx), mRNA.
ACCESSION   NM_001318744 XM_002938411
VERSION     NM_001318744.1
KEYWORDS    RefSeq.
SOURCE      Xenopus tropicalis (tropical clawed frog)
  ORGANISM  Xenopus tropicalis
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Amphibia; Batrachia; Anura; Pipoidea; Pipidae; Xenopodinae;
            Xenopus; Silurana.
COMMENT     PROVISIONAL REFSEQ: This record has not yet been subject to final
            NCBI review. The reference sequence was derived from KT351730.1.
            On Jan 9, 2016 this sequence version replaced XM_002938411.3.
            
            ##Evidence-Data-START##
            Transcript exon combination :: KT351730.1, BX743598.1 [ECO:0000332]
            RNAseq introns              :: single sample supports all introns
                                           SAMD00028290, SAMD00028291
                                           [ECO:0000348]
            ##Evidence-Data-END##
FEATURES             Location/Qualifiers
     source          1..1479
                     /organism="Xenopus tropicalis"
                     /mol_type="mRNA"
                     /db_xref="taxon:8364"
                     /chromosome="9"
                     /map="9"
     gene            1..1479
                     /gene="uncx"
                     /gene_synonym="uncx-4.1; uncx4.1"
                     /note="UNC homeobox"
                     /db_xref="GeneID:100492016"
                     /db_xref="Xenbase:XB-GENE-920201"
     CDS             12..1463
                     /gene="uncx"
                     /gene_synonym="uncx-4.1; uncx4.1"
                     /note="UNC homeobox transcription factor"
                     /codon_start=1
                     /product="homeobox protein unc-4 homolog"
                     /protein_id="NP_001305673.1"
                     /db_xref="GeneID:100492016"
                     /db_xref="Xenbase:XB-GENE-920201"
                     /translation="
MMDSRILEHPHAQFGGSMSGMVGFPYPLGHHHVYELASHQLQSAAAAVPFSIDGLLNGSCTASVINPTPLLPSGCGLNGDSQQYKLSDSIDPDKESPGCKRRRTRTNFTGWQLEELEKAFNESHYPDVFMREALALRLDLVESRVQVWFQNRRAKWRKKENTKKGPGRPAHNSHPTTCSGEPMDPEEIARKELEKMEKKKRKQEKKMLRNQNRLQHSPGDMSLHTPSSDSDSGLSQNLDSSSLESSHPDMGQSRSQTQASCDQTGQAFFQSQRNTGQRDRVSDKESPVEANHNSGLCPNGRGAAFQKLNPFSVESLLSDSPPKRKTGIEFPGLTNPRTLIGKGHFLLYPITQPLGFIVPQASIKSNSAQELPSPGIKDSLHNSNSGQPSLNTSPNSAQNLYPNKHTNSTQSTTLTVCKTENGDHHGATSSSGDTGTEQLDSTYSEPKSPKSLKSDRETPECPNGSTSTCPPKPSLDCEEVDMD"
     misc_feature    312..491
                     /gene="uncx"
                     /gene_synonym="uncx-4.1; uncx4.1"
                     /note="Region: homeobox domain"
     misc_feature    order(315..329,333..335,384..386,402..404,441..443,
                     447..452,459..464,468..476,480..485)
                     /gene="uncx"
                     /gene_synonym="uncx-4.1; uncx4.1"
                     /note="DNA binding site [nucleotide binding]"
                     /db_xref="CDD:238039"
     misc_feature    321..482
                     /gene="uncx"
                     /gene_synonym="uncx-4.1; uncx4.1"
                     /note="Homeobox domain; Region: Homeobox; pfam00046"
                     /db_xref="CDD:278475"
     misc_feature    order(321..323,330..332,450..452,459..464,471..473)
                     /gene="uncx"
                     /gene_synonym="uncx-4.1; uncx4.1"
                     /note="specific DNA base contacts [nucleotide binding];
                     other site"
                     /db_xref="CDD:238039"
ORIGIN      
tacccagggagatgatggacagtaggattctagagcaccctcatgcccagtttggaggctccatgagtggcatggtgggcttcccttacccactcggccaccaccatgtgtatgagttagccagccaccagctgcagtcggcagcagccgccgtgcccttctctatagacggattactgaatggttcctgcactgcatctgttatcaacccgacccccctgctcccctctggatgtgggctgaacggagacagtcagcaatacaagctgtcagactcgattgacccggacaaggaaagccccggctgcaagagaagaaggacccggaccaacttcaccggctggcagttagaggagctggagaaggctttcaatgagagtcactatccggatgtgtttatgagagaggccctggccttgaggctggacctagtggagtcccgagttcaggtctggttccaaaaccgcagagctaagtggagaaagaaagagaacaccaagaagggcccagggaggccagcccataattcccaccccaccacctgcagtggagagcccatggaccccgaggagatagccaggaaggagctggagaaaatggagaaaaagaagcgaaagcaagagaagaagatgttaaggaaccagaaccgactccagcactctccaggcgacatgtccctgcacacccccagctctgacagtgacagtggactctcccagaaccttgactccagctcactggagagcagccatcctgatatgggacaaagcagaagccaaacccaagcaagctgtgaccaaacaggacaagcctttttccaaagccaaagaaacacaggacaaagggacagggtcagtgacaaggagtcaccggttgaagccaaccacaactcaggcttgtgcccaaatgggagaggcgctgccttccagaaactcaatcccttcagcgtagaaagcctgttgtctgactctccccccaaacggaagacagggatagaatttccaggtttaacgaacccccgaaccttaattgggaagggacattttctgctgtaccccatcacccaacctctgggatttatagtaccgcaggcttccattaaatccaactcagcccaggaactgcccagtcctgggattaaggactctcttcataacagtaactcgggtcagcccagtctaaatacctccccgaactcagcacagaacttataccccaacaaacacacgaactcaacccagagcaccactctaacagtatgtaagactgagaatggtgaccaccatggggcaacctccagctctggagacacagggactgagcagttggacagcacatattctgagccaaagtctcccaagtccctgaaaagcgacagagagaccccagagtgtccgaatggctcaacttctacctgcccgcccaaacccagcttagactgtgaagaggtagatatggactaagcctcccctcatcctt
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]