GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2026-06-15 02:44:13, GGRNA.v2 : RefSeq release 233 (Jan, 2026)

LOCUS       NM_001318310             713 bp    mRNA    linear   INV 01-DEC-2025
DEFINITION  Caenorhabditis elegans Reverse transcriptase domain-containing
            protein (eri-3), partial mRNA.
ACCESSION   NM_001318310
VERSION     NM_001318310.3
DBLINK      BioProject: PRJNA158
KEYWORDS    RefSeq.
SOURCE      Caenorhabditis elegans
  ORGANISM  Caenorhabditis elegans
            Eukaryota; Metazoa; Ecdysozoa; Nematoda; Chromadorea; Rhabditida;
            Rhabditina; Rhabditomorpha; Rhabditoidea; Rhabditidae; Peloderinae;
            Caenorhabditis.
REFERENCE   1  (bases 1 to 713)
  AUTHORS   Sulson,J.E. and Waterston,R.
  CONSRTM   Caenorhabditis elegans Sequencing Consortium
  TITLE     Genome sequence of the nematode C. elegans: a platform for
            investigating biology
  JOURNAL   Science 282 (5396), 2012-2018 (1998)
   PUBMED   9851916
  REMARK    Erratum:[Science 1999 Jan 1;283(5398):35]
REFERENCE   2  (bases 1 to 713)
  CONSRTM   NCBI Genome Project
  TITLE     Direct Submission
  JOURNAL   Submitted (01-DEC-2025) National Center for Biotechnology
            Information, NIH, Bethesda, MD 20894, USA
REFERENCE   3  (bases 1 to 713)
  AUTHORS   WormBase.
  CONSRTM   WormBase Consortium
  TITLE     Direct Submission
  JOURNAL   Submitted (10-OCT-2025) WormBase Group, European Bioinformatics
            Institute, Cambridge, CB10 1SA, UK. Email: help@wormbase.org
REFERENCE   4  (bases 1 to 713)
  AUTHORS   Sulson,J.E. and Waterston,R.
  TITLE     Direct Submission
  JOURNAL   Submitted (03-MAR-2003) Nematode Sequencing Project: Sanger
            Institute, Hinxton, Cambridge CB10 1SA, UK and The Genome Institute
            at Washington University, St. Louis, MO 63110, USA
COMMENT     REVIEWED REFSEQ: This record has been curated by WormBase. This
            record is derived from an annotated genomic sequence (NC_003280).
            
            On Apr 15, 2020 this sequence version replaced NM_001318310.2.
            COMPLETENESS: incomplete on the 5' end.
FEATURES             Location/Qualifiers
     source          1..713
                     /organism="Caenorhabditis elegans"
                     /mol_type="mRNA"
                     /strain="Bristol N2"
                     /db_xref="taxon:6239"
                     /chromosome="II"
     gene            <1..713
                     /gene="eri-3"
                     /locus_tag="CELE_W09B6.3"
                     /db_xref="GeneID:173497"
                     /db_xref="WormBase:WBGene00021103"
     CDS             1..687
                     /gene="eri-3"
                     /locus_tag="CELE_W09B6.3"
                     /standard_name="W09B6.3c"
                     /note="Partially confirmed by transcript evidence"
                     /codon_start=1
                     /product="Reverse transcriptase domain-containing protein"
                     /protein_id="NP_001305239.1"
                     /db_xref="GeneID:173497"
                     /db_xref="WormBase:WBGene00021103"
                     /translation="
MTNCLKFNSKSAQFKLRHLILDRCFSELPEREAKSIINSYFIDRLAEGIKIEKIDKNWRTFGEILPKTPKKYSESLKKSIQNVLEPFGLNKPEKAAETPKIVEYFPKNPKKRVEIVEKPTVDEIRELFGALMDAEGFALNQRVKPHFVLPDTRWKPTERRYIGIYDDVQWTFMSTFCPKIEENSENRPLAGGWWYRRTVPRDHPVEIVQKMETRRNIIKDCTESPFIE"
ORIGIN      
atgacgaattgcctgaaattcaactcgaaaagtgctcaattcaagctccgacatctcatcctcgacagatgcttcagcgaattaccggaacgcgaggccaaatcgattatcaactcgtattttatcgatcgacttgccgagggcataaaaatcgagaaaatcgacaaaaattggaggacatttggtgaaattttgccgaaaactccaaaaaagtacagcgaatcgctgaaaaaatcgattcaaaacgttttggaaccatttggcctcaacaaaccggaaaaagcagcggaaactccaaaaattgtggaatatttcccgaaaaatccgaaaaaacgtgtggaaatcgttgaaaaaccgacggtcgacgagattcgcgagctctttggagcacttatggacgcggagggttttgcgttgaatcaacgtgtgaagccgcatttcgtgctacccgatactcgctggaagcccacagaacggagatatattggaatctacgacgacgtgcaatggacgtttatgagcacattttgcccgaaaatcgaggaaaattccgaaaatcgaccgctcgccggcgggtggtggtaccggcgaaccgtcccacgggaccatcccgtcgaaattgtgcagaaaatggaaactcggcggaatattatcaaagattgtacagaatccccgtttattgaatgaaaaactaactcgtgtgaatttaaaaa
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]