ver.2
Home
|
Help
|
Advanced search
Previous release (v1)
2025-11-18 07:25:13, GGRNA.v2 : RefSeq release 232 (Sep, 2025)
LOCUS NM_001318310 713 bp mRNA linear INV 16-MAY-2025
DEFINITION Caenorhabditis elegans Reverse transcriptase domain-containing
protein (eri-3), partial mRNA.
ACCESSION NM_001318310
VERSION NM_001318310.3
DBLINK BioProject: PRJNA158
KEYWORDS RefSeq.
SOURCE Caenorhabditis elegans
ORGANISM Caenorhabditis elegans
Eukaryota; Metazoa; Ecdysozoa; Nematoda; Chromadorea; Rhabditida;
Rhabditina; Rhabditomorpha; Rhabditoidea; Rhabditidae; Peloderinae;
Caenorhabditis.
REFERENCE 1 (bases 1 to 713)
AUTHORS Sulson,J.E. and Waterston,R.
CONSRTM Caenorhabditis elegans Sequencing Consortium
TITLE Genome sequence of the nematode C. elegans: a platform for
investigating biology
JOURNAL Science 282 (5396), 2012-2018 (1998)
PUBMED 9851916
REMARK Erratum:[Science 1999 Jan 1;283(5398):35]
REFERENCE 2 (bases 1 to 713)
CONSRTM NCBI Genome Project
TITLE Direct Submission
JOURNAL Submitted (16-MAY-2025) National Center for Biotechnology
Information, NIH, Bethesda, MD 20894, USA
REFERENCE 3 (bases 1 to 713)
AUTHORS WormBase.
CONSRTM WormBase Consortium
TITLE Direct Submission
JOURNAL Submitted (01-MAY-2025) WormBase Group, European Bioinformatics
Institute, Cambridge, CB10 1SA, UK. Email: help@wormbase.org
REFERENCE 4 (bases 1 to 713)
AUTHORS Sulson,J.E. and Waterston,R.
TITLE Direct Submission
JOURNAL Submitted (03-MAR-2003) Nematode Sequencing Project: Sanger
Institute, Hinxton, Cambridge CB10 1SA, UK and The Genome Institute
at Washington University, St. Louis, MO 63110, USA
COMMENT REVIEWED REFSEQ: This record has been curated by WormBase. This
record is derived from an annotated genomic sequence (NC_003280).
On Apr 15, 2020 this sequence version replaced NM_001318310.2.
COMPLETENESS: incomplete on the 5' end.
FEATURES Location/Qualifiers
source 1..713
/organism="Caenorhabditis elegans"
/mol_type="mRNA"
/strain="Bristol N2"
/db_xref="taxon:6239"
/chromosome="II"
gene <1..713
/gene="eri-3"
/locus_tag="CELE_W09B6.3"
/db_xref="GeneID:173497"
/db_xref="WormBase:WBGene00021103"
CDS 1..687
/gene="eri-3"
/locus_tag="CELE_W09B6.3"
/standard_name="W09B6.3c"
/note="Partially confirmed by transcript evidence"
/codon_start=1
/product="Reverse transcriptase domain-containing protein"
/protein_id="NP_001305239.1"
/db_xref="GeneID:173497"
/db_xref="WormBase:WBGene00021103"
/translation="
MTNCLKFNSKSAQFKLRHLILDRCFSELPEREAKSIINSYFIDRLAEGIKIEKIDKNWRTFGEILPKTPKKYSESLKKSIQNVLEPFGLNKPEKAAETPKIVEYFPKNPKKRVEIVEKPTVDEIRELFGALMDAEGFALNQRVKPHFVLPDTRWKPTERRYIGIYDDVQWTFMSTFCPKIEENSENRPLAGGWWYRRTVPRDHPVEIVQKMETRRNIIKDCTESPFIE"
ORIGIN
atgacgaattgcctgaaattcaactcgaaaagtgctcaattcaagctccgacatctcatcctcgacagatgcttcagcgaattaccggaacgcgaggccaaatcgattatcaactcgtattttatcgatcgacttgccgagggcataaaaatcgagaaaatcgacaaaaattggaggacatttggtgaaattttgccgaaaactccaaaaaagtacagcgaatcgctgaaaaaatcgattcaaaacgttttggaaccatttggcctcaacaaaccggaaaaagcagcggaaactccaaaaattgtggaatatttcccgaaaaatccgaaaaaacgtgtggaaatcgttgaaaaaccgacggtcgacgagattcgcgagctctttggagcacttatggacgcggagggttttgcgttgaatcaacgtgtgaagccgcatttcgtgctacccgatactcgctggaagcccacagaacggagatatattggaatctacgacgacgtgcaatggacgtttatgagcacattttgcccgaaaatcgaggaaaattccgaaaatcgaccgctcgccggcgggtggtggtaccggcgaaccgtcccacgggaccatcccgtcgaaattgtgcagaaaatggaaactcggcggaatattatcaaagattgtacagaatccccgtttattgaatgaaaaactaactcgtgtgaatttaaaaa
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]