GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2019-03-25 14:33:48, GGRNA.v2 : RefSeq release 92 (Jan, 2019)

LOCUS       NM_001309211            5334 bp    mRNA    linear   PLN 07-SEP-2017
DEFINITION  Zea mays homeobox 3 (hox3), mRNA.
ACCESSION   NM_001309211 XM_008675214
VERSION     NM_001309211.1
KEYWORDS    RefSeq.
SOURCE      Zea mays
  ORGANISM  Zea mays
            Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta;
            Spermatophyta; Magnoliophyta; Liliopsida; Poales; Poaceae; PACMAD
            clade; Panicoideae; Andropogonodae; Andropogoneae; Tripsacinae;
            Zea.
REFERENCE   1  (bases 1 to 5334)
  AUTHORS   Klinge B, Uberlacker B, Korfhage C and Werr W.
  TITLE     ZmHox: a novel class of maize homeobox genes
  JOURNAL   Plant Mol. Biol. 30 (3), 439-453 (1996)
   PUBMED   8605297
COMMENT     VALIDATED REFSEQ: This record has undergone validation or
            preliminary review. The reference sequence was derived from
            LPUQ01001404.1.
            On May 21, 2015 this sequence version replaced XM_008675214.1.
            
            ##Evidence-Data-START##
            Transcript exon combination :: SRR3147055.16267.1,
                                           SRR3147056.12016.1 [ECO:0000332]
            RNAseq introns              :: mixed/partial sample support
                                           SAMN00780084, SAMN00780085
                                           [ECO:0000350]
            ##Evidence-Data-END##
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-292               LPUQ01001404.1     197867-198158
            293-1582            LPUQ01001404.1     199773-201062
            1583-1748           LPUQ01001404.1     201507-201672
            1749-1872           LPUQ01001404.1     201761-201884
            1873-1985           LPUQ01001404.1     201971-202083
            1986-2142           LPUQ01001404.1     202168-202324
            2143-2501           LPUQ01001404.1     206170-206528
            2502-2768           LPUQ01001404.1     207819-208085
            2769-2858           LPUQ01001404.1     208218-208307
            2859-3197           LPUQ01001404.1     208413-208751
            3198-3482           LPUQ01001404.1     208869-209153
            3483-3572           LPUQ01001404.1     209277-209366
            3573-5334           LPUQ01001404.1     209455-211216
FEATURES             Location/Qualifiers
     source          1..5334
                     /organism="Zea mays"
                     /mol_type="mRNA"
                     /cultivar="B73"
                     /db_xref="taxon:4577"
                     /chromosome="3"
                     /map="3"
     gene            1..5334
                     /gene="hox3"
                     /gene_synonym="GRMZM2G314546; homeobox3; Hox2a"
                     /note="homeobox 3"
                     /db_xref="GeneID:542440"
     misc_feature    321..323
                     /gene="hox3"
                     /gene_synonym="GRMZM2G314546; homeobox3; Hox2a"
                     /note="upstream in-frame stop codon"
     CDS             339..5072
                     /gene="hox3"
                     /gene_synonym="GRMZM2G314546; homeobox3; Hox2a"
                     /note="CL2032_1; CL2032_1a; cl2032_1(265); ZmHox2a"
                     /codon_start=1
                     /product="homeobox 3"
                     /protein_id="NP_001296140.1"
                     /db_xref="GeneID:542440"
                     /translation="
MGRKGSEVSPSKRYPLRSAHSSGRVLRSALANNNKDSEPLNAAAATQAAVKKRSGNQLDSPNSTVRLLRSTSKNKDEAHSGPLNDRIIDKPAANKRKHANPSQVGSPSSSVRVLRSAIKNKDMARSEPQSDRTAGEAATNKRKNANSSKVGSLSSGLSVLRSASKAKDETCIKPLNDSAAVEPASSKRKCTSPSKVGSPSNSVRVLRSTSKYKNETCTEPLNDSGAVEPAANRRKGVSRSKEGSPNSSVRVLRSASNNKIDVSIEPLNNSTTGQPAAKRRKNGSSFKSSARVLCSTSERANEASSEPLNDSTAAQPAARKKKGGAMPKTDNPKIGVRVLRSASGKKNETCTEPVNGSTSAEPTVTKKRNCKPSKDRSPKKDYLKICQRIKYILNRMKYEQAFIQAYASEGWKGQSLEKIRPEKELERAKAEILQCKLRIREAFRNMDSLLSKGKLEESLFDSAGQISSEDIFCAICGSKDVTSQNDIILCDGACDRGFHQNCLSPPLLTEEIPPGDEGWLCPACVCKADYIDALNELQGSKLSIHDSWVKVFPEAASTANGSKQVDASDLLPDHIKDSANLALVGTHMVNEIRFSEEDDSKADDLGLPSEDSGDGDFDPAGPDSSEDQNDGLNSEESDFTSDSDYFCAEIAKSCGQDEVSASPLSNVINRTDRMKLRAYSRRSNEENHNHAFMDMELEQDIVLPVPSRRQVERLDYKKLYDEAYEEESSNSSDEEEWSGKELLEGSGTDSLDERLRPVKRCSRRAPAGQQNNELTPQSRPHGSNSEQKTEVLRSNGSSSTGRKYDPEVTQKLKVHFEKDPYPSRETKENLSEELGLTFNQVSKWFSSTRHYSRVASAKKEMHPDSHTCENNDETTVDSMQAKQPNAGVMEKLTGDRNGIVPEKPMVQDNLNQGAMEKLTRDKNDIVPEKPVMQSSLNQCNNEDIPLSGTEIEMESYEQESSDSSDEEWSILSTPRKTRLQDHGKSSVTESLRSAKRCSRRAPAREQNNERIQSEQLHGSASEQQTEFLRSNVSSGKVSKYHFGPIVSQKLKEHFEKDPYPCRATKESLAQELGLTFNQISKWFSGTRHYSRDAVAKNQKRPGENTTVNNNSTTFDDIQVIEPNVGLIDKPAADVNDMISEKLMVQINLNEGIEEDIPPSQYARCEEKITMTPAAISREAGLPGYGPGPGENFLQVSSRNTSCEQSVILAPTAIAREVGPPGYATGENQGNGAPWNTSYERRLFMNPVTSSRAVSPPGYGPEESRGSGISWNTSSEQILFMSPTTISRELGPPGYGPREDQCSGTSWNASCELGVFMSPVTTSREDSPPGYGPRENQENDNMRCELRMFTSPTTISREVGPPGYELTGKNKGNGASCTTNYQQGAFTSPEAFPREACPPGFVSGENQGNDTPWYMSSKQMAFTSPTTNPRVGPPGYGQENQGSRVSWNTSYEQGVFMSSTNISREAGPPGYGPGESQGNITSWISTGGQRMFTGPSTIPNEVGQQGYGPSGIPGTDGSRSMDLKAFPPGYGPAGENQGGGASGSVISPQARSAENVEFSDDARKKAIQRELRRRQKFR"
     misc_feature    1752..1910
                     /gene="hox3"
                     /gene_synonym="GRMZM2G314546; homeobox3; Hox2a"
                     /note="PHD finger found in Arabidopsis thaliana
                     pathogenesis-related homeodomain protein (PRHA) and
                     similar proteins; Region: PHD_PRHA_like; cd15504"
                     /db_xref="CDD:276979"
     misc_feature    order(1752..1754,1794..1808,1821..1823,1893..1895)
                     /gene="hox3"
                     /gene_synonym="GRMZM2G314546; homeobox3; Hox2a"
                     /note="putative histone H3 binding site [polypeptide
                     binding]; other site"
                     /db_xref="CDD:276979"
     misc_feature    order(1755..1757,1764..1766,1806..1808,1818..1820,
                     1833..1835,1842..1844,1899..1901,1908..1910)
                     /gene="hox3"
                     /gene_synonym="GRMZM2G314546; homeobox3; Hox2a"
                     /note="Zn binding site [ion binding]; other site"
                     /db_xref="CDD:276979"
     misc_feature    2742..2897
                     /gene="hox3"
                     /gene_synonym="GRMZM2G314546; homeobox3; Hox2a"
                     /note="Homeodomain; DNA binding domains involved in the
                     transcriptional regulation of key eukaryotic developmental
                     processes; may bind to DNA as monomers or as homo- and/or
                     heterodimers, in a sequence-specific manner; Region:
                     homeodomain; cd00086"
                     /db_xref="CDD:238039"
     misc_feature    order(2745..2747,2865..2867,2874..2879,2886..2888)
                     /gene="hox3"
                     /gene_synonym="GRMZM2G314546; homeobox3; Hox2a"
                     /note="specific DNA base contacts [nucleotide binding];
                     other site"
                     /db_xref="CDD:238039"
     misc_feature    3453..3611
                     /gene="hox3"
                     /gene_synonym="GRMZM2G314546; homeobox3; Hox2a"
                     /note="Homeodomain; DNA binding domains involved in the
                     transcriptional regulation of key eukaryotic developmental
                     processes; may bind to DNA as monomers or as homo- and/or
                     heterodimers, in a sequence-specific manner; Region:
                     homeodomain; cd00086"
                     /db_xref="CDD:238039"
     misc_feature    order(3459..3461,3579..3581,3588..3593,3600..3602)
                     /gene="hox3"
                     /gene_synonym="GRMZM2G314546; homeobox3; Hox2a"
                     /note="specific DNA base contacts [nucleotide binding];
                     other site"
                     /db_xref="CDD:238039"
     misc_feature    <3906..>4619
                     /gene="hox3"
                     /gene_synonym="GRMZM2G314546; homeobox3; Hox2a"
                     /note="Epstein-Barr virus nuclear antigen 3 (EBNA-3);
                     Region: EBV-NA3; cl27975"
                     /db_xref="CDD:332796"
     misc_feature    4437..>4985
                     /gene="hox3"
                     /gene_synonym="GRMZM2G314546; homeobox3; Hox2a"
                     /note="ARC105 or Med15 subunit of Mediator complex
                     non-fungal; Region: Med15; pfam09606"
                     /db_xref="CDD:312941"
ORIGIN      
gagtcaatcttggttcatcaaagtaaaaaaggcagaaaacagacacgatgacatctgtttttgacgccttgattaaacacgtggccagcggcctgctacagcctactgcctacagatgcaaatcagtaccaggcgtgctctccgtgagctctacgcctctacctgtgtcttggcgacgactgggcgaccgacgacgcagccgtaggacaggcgaccgacgacgcagccgtaggataggcgaccaggtcttcctgttggctcttgcccttcgccggcgacgagcacccgccagggccacaacgacattgggaacaagtgtatgacatacaaacagtaaaatgggaaggaaagggtcagaagtatcaccaagcaaaaggtatcccttgaggtctgcacatagtagtggtagagttcttcgctctgccttagccaataataataaggacagtgagcctctgaatgcggctgctgctacccaagcagctgtgaaaaaaagaagtggcaaccagctagatagtcctaatagcactgtcaggctacttcgttctacatcaaaaaataaggacgaggcacatagcgggcctctaaatgacaggatcattgataagccagctgcaaataaaagaaaacatgccaatccctcacaggttggaagtcccagcagcagtgtcagggtgcttcgctctgcaataaaaaataaagatatggcgcgcagtgagcctcaaagtgacaggaccgctggtgaggcagctacaaataaaagaaaaaacgccaattcctcaaaggtggggagtctgagctctggtctcagtgtgcttcggtctgcttcaaaagctaaggatgagacatgtatcaaacctttaaatgatagtgctgctgttgaaccagcttcaagtaaaagaaaatgcaccagtccgtcaaaggtgggaagtcccagcaacagtgtcagggtgcttcgatctacttcaaaatataagaatgagacatgtaccgagcctttaaatgatagtggtgctgttgaaccagctgcaaatagaaggaaaggtgtcagtcgttcaaaggagggaagtcccaatagcagtgtcagggtgcttcgctctgcctcaaataataagattgatgtatctattgagccactaaataatagtactactggtcaaccagctgcgaaaagaagaaagaatggcagttcctttaagagcagtgccagggtgctttgctctacctcagaaagggcaaatgaggcatctagtgagcctttaaatgatagtactgctgctcagccagctgcgaggaaaaagaaaggtggtgcaatgccaaagactgataacccaaagattggtgtcagggttcttcgctctgcctcaggaaagaagaatgagacatgtactgagcctgtaaatggcagtacttctgctgaaccaactgtgacaaaaaaaagaaattgcaagccttcaaaggatcgcagtcccaagaaggactacttaaaaatttgtcaaagaattaaatatattttgaatcgaatgaagtatgaacaagcctttattcaggcttatgcaagtgaaggttggaaaggccaaagtttggaaaaaataagacccgagaaggagcttgaacgagccaaggcagaaatccttcaatgcaagttaagaatccgggaagcttttcgaaatatggactctcttttatcgaaggggaagcttgaagaatctttgtttgattcagcaggacaaatttcaagcgaagatatattttgtgccatatgtggctcaaaggatgttacttcacaaaatgacatcattctttgtgatggagcctgtgacagaggattccaccagaattgtttgagccctcctttgctaactgaagaaattcctccgggggatgaaggatggctttgccctgcatgtgtgtgcaaagcagactatatagatgcgttaaatgaacttcaaggaagcaaactctccattcatgactcatgggtgaaagttttccctgaggcagcttcaactgccaatggttctaaacaagttgatgcttctgatctgctgccagatcatataaaggacagtgctaaccttgcattggttggaacgcacatggtgaatgaaatcaggttttctgaagaggatgatagcaaagcggatgacctcggcttgccttcggaggactcaggggatggtgacttcgatccagcaggtccagattctagtgaagaccaaaatgatggattgaactcagaagagtcagatttcacatctgactctgattatttttgtgctgagattgctaaatcttgcggccaggatgaagtctcggcatctccattatcaaatgtgataaaccgtactgatagaatgaaactcagggcctacagtagacgctctaatgaagaaaaccacaatcatgcatttatggacatggagctagagcaagacatagtgctaccagttccaagcaggcggcaggttgaacggttggattacaaaaaactatacgatgaggcatatgaggaagaatcatctaattcaagtgatgaagaagagtggtctggaaaagaactcttagaaggcagtggaacagattcacttgatgagcgacttcgtcctgtaaaacggtgctctagaagagcaccagcagggcagcagaataatgaacttacaccacagagccggcctcatggttctaacagtgagcagaaaactgaagttcttcgctccaatggcagtagtagcacaggacggaagtatgatcctgaagttacccagaaattgaaggtgcattttgagaaagatccatatcctagccgtgaaacaaaagaaaatctatcagaagaactaggcttgacatttaatcaggtctccaaatggttctctagtactcgtcactattcaagggttgcttctgccaaaaaagaaatgcatcctgacagccatacttgtgagaataatgatgagacaactgtagacagcatgcaagcaaaacaacccaatgctggggtgatggaaaagttgacgggggatagaaatggcattgttcctgagaaaccgatggtgcaggacaatcttaaccaaggagcgatggaaaagttaactagggataaaaatgacattgttcctgagaaaccggtgatgcagagcagtcttaaccaatgtaataatgaagatataccgctttctggaacagaaattgagatggagtcttacgaacaagaatcatctgactcaagtgatgaagagtggtccatacttagcacaccacgaaaaacaagattacaagaccatggaaaatcatcagttactgaatcacttcgttctgcaaaacggtgttccagaagagcaccagctagggagcagaataatgaacgtattcagagtgagcagcttcatggttctgcaagtgagcagcaaactgaatttcttcgctccaatgtcagcagtggcaaggtctcaaaatatcattttggccctatagttagtcagaagcttaaggaacattttgaaaaagatccatatccttgccgtgcaacaaaagagagtctggcacaagagctaggactgacatttaatcagatcagtaagtggttctctggcactcgtcattattcaagagatgctgttgccaagaatcagaaacgcccgggagaaaatactactgtgaataataatagcacaacctttgatgacatacaagtaatagaacccaatgttgggttgatagataaaccagctgcagatgtaaatgacatgatttctgaaaagttgatggtccaaataaatcttaacgaaggcattgaagaagatatcccaccgagccaatatgccaggtgtgaagagaaaataactatgactccagctgccatctcaagggaagctggtcttccaggatatggtcctggtcctggagaaaactttcttcaggtcagttcaaggaatactagctgtgagcagagtgtgatactggctcctaccgctatcgcaagagaagttggtccaccaggatatgcgactggagaaaaccagggcaatggggctccatggaatacaagttatgagcgaagactatttatgaatcctgtgaccagctcaagagcagtcagtcctccaggatatgggcctgaagaaagccgaggcagtggcatttcctggaatacaagcagtgaacaaatattgtttatgagtcctacaaccatctcaagagaacttggtccaccaggatatgggcctagagaagaccagtgcagtggcacttcatggaatgcaagctgcgagttgggagtatttatgagtcctgtgaccacctcaagagaagacagtccgccaggatatgggcctcgagaaaaccaggagaatgacaatatgagatgcgagttgagaatgtttacaagtcctacaaccatctccagagaagttggcccaccaggatatgagcttactggaaaaaacaagggcaacggcgcttcatgtactacgaattaccagcagggagcgtttacgagtcctgaagccttcccaagagaagcctgtcctccaggatttgtgtctggagagaaccagggtaacgacactccatggtatatgagcagcaaacagatggcgtttacgagtcctacgaccaaccctagagtaggtccgccagggtatggacaggaaaaccagggcagtcgtgtttcttggaatacgagttatgagcagggagtgtttatgagttctacaaacatctcaagagaagccggtccgccaggttatgggcctggggaaagtcagggcaatatcacttcatggatttcgacaggcgggcagagaatgtttacaggtccttcaactatcccgaacgaagtcgggcagcaaggatatggcccttcaggaatcccgggaacggatggctcaaggagtatggacttgaaagcctttccaccaggatatggacctgctggagaaaaccagggcggtggtgcttcagggagcgtcataagcccccaagctcggtctgcagagaacgtagagttttcagacgacgctagaaaaaaggctatacagcgggagctgagacggcggcagaagttcaggtgatggccgtgatgcgaatttctgatcttgctcatcgaattttgactacggattactactttttaagactacatatccagtcttgatggctgaatgagtgacgaccctagttgtcgagacgcaaaaccttttgttgtatgtgttccttttacagacttccttggcttgtcatgaatttctaatgtgaacttgtgctgtgaacttgttgcaaaacctcttgaacctgaagcattcaacatgatgtgagcttgtgcagttactcttc
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]