2024-04-20 04:30:08, GGRNA.v2 : RefSeq release 222 (Jan, 2024)
LOCUS NM_001285465 1991 bp mRNA linear MAM 14-JUN-2023 DEFINITION Sus scrofa cyclin dependent kinase 2 (CDK2), mRNA. ACCESSION NM_001285465 XM_003481615 VERSION NM_001285465.1 KEYWORDS RefSeq. SOURCE Sus scrofa (pig) ORGANISM Sus scrofa Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Laurasiatheria; Artiodactyla; Suina; Suidae; Sus. REFERENCE 1 (bases 1 to 1991) AUTHORS Mulligan MK, Kleiman JE, Caldemeyer AC, Harding JCS and Pasternak JA. TITLE Porcine reproductive and respiratory virus 2 infection of the fetus results in multi-organ cell cycle suppression JOURNAL Vet Res 53 (1), 13 (2022) PUBMED 35189966 REMARK GeneRIF: Expression of CDK2 is down regulated in the heart, kidney, spleen, thymus and skeletal muscle of late gestation fetuses compromised by viral infection Publication Status: Online-Only REFERENCE 2 (bases 1 to 1991) AUTHORS Wang H and Kim NH. TITLE CDK2 Is Required for the DNA Damage Response During Porcine Early Embryonic Development JOURNAL Biol Reprod 95 (2), 31 (2016) PUBMED 27307074 REMARK GeneRIF: our results indicate that an ATM-P53-P21 DNA damage checkpoint is intact in the absence of CDK2; however, CDK2 is important for proper repair of the damaged DNA by either directly or indirectly influencing DNA repair-related gene expression. REFERENCE 3 (bases 1 to 1991) AUTHORS Tang Q, Li S, Zhang H, Wei Y, Wu H, Liu J, Wang Y, Liu D, Zhang Z and Liu C. TITLE Correlation of the cyclin A expression level with porcine circovirus type 2 propagation efficiency JOURNAL Arch Virol 158 (12), 2553-2560 (2013) PUBMED 23836398 REFERENCE 4 (bases 1 to 1991) AUTHORS Sugiura K, Naito K and Tojo H. TITLE Cdk2 activity is essential for the first to second meiosis transition in porcine oocytes JOURNAL J Reprod Dev 51 (1), 143-149 (2005) PUBMED 15750306 REFERENCE 5 (bases 1 to 1991) AUTHORS Uenishi H, Eguchi T, Suzuki K, Sawazaki T, Toki D, Shinkai H, Okumura N, Hamasima N and Awata T. TITLE PEDE (Pig EST Data Explorer): construction of a database for ESTs derived from porcine full-length cDNA libraries JOURNAL Nucleic Acids Res 32 (Database issue), D484-D488 (2004) PUBMED 14681463 COMMENT PROVISIONAL REFSEQ: This record has not yet been subject to final NCBI review. The reference sequence was derived from JX967576.1. On Oct 27, 2013 this sequence version replaced XM_003481615.2. ##Evidence-Data-START## Transcript exon combination :: JX967576.1, SRR5250921.212417.1 [ECO:0000332] RNAseq introns :: single sample supports all introns SAMEA103886111, SAMEA103886115 [ECO:0000348] ##Evidence-Data-END## PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP 1-1991 JX967576.1 4-1994 FEATURES Location/Qualifiers source 1..1991 /organism="Sus scrofa" /mol_type="mRNA" /db_xref="taxon:9823" /chromosome="5" /map="5" gene 1..1991 /gene="CDK2" /note="cyclin dependent kinase 2" /db_xref="GeneID:100154715" /db_xref="VGNC:VGNC:111748" exon 1..254 /gene="CDK2" /inference="alignment:Splign:2.1.0" misc_feature 130..132 /gene="CDK2" /note="upstream in-frame stop codon" CDS 139..1035 /gene="CDK2" /note="porcine cyclin dependent kinase 2; cyclin-dependent kinase-2 alpha" /codon_start=1 /product="cyclin-dependent kinase 2" /protein_id="NP_001272394.1" /db_xref="GeneID:100154715" /db_xref="VGNC:VGNC:111748" /translation="
MENFQKVEKIGEGTYGVVYKAKNKVTGEVVALKKIRLDTETEGVPSTAIREISLLKELNHPNIVKLLDVIHTENKLYLVFEFLHQDLKKFMDASALTGIPLPLIKSYLFQLLQGLAFCHSHRVLHRDLKPQNLLINAEGSIKLADFGLARAFGVPVRTYTHEVVTLWYRAPEILLGCKYYSTAVDIWSLGCIFAEMVTRRALFPGDSEIDQLFRIFRTLGTPDEVVWPGVTSMPDYKPSFPKWARQDFSKVVPPLDEDGRSLLSQMLHYDPNKRISAKAALAHPFFQDVTKPVPHLRL"
misc_feature 145..996 /gene="CDK2" /note="Catalytic domain of the Serine/Threonine Kinases, Cyclin-Dependent protein Kinase 2 and 3; Region: STKc_CDK2_3; cd07860" /db_xref="CDD:270844" misc_feature order(166..177,190..192,229..231,235..237,286..288, 328..330,376..387,394..396,400..405,517..519,523..525, 529..534,538..540,571..573,580..582,616..618,622..633, 637..639,751..756) /gene="CDK2" /note="active site" /db_xref="CDD:270844" misc_feature order(166..177,190..192,229..231,235..237,328..330, 376..387,394..396,403..405,529..534,538..540,571..573) /gene="CDK2" /note="ATP binding site [chemical binding]; other site" /db_xref="CDD:270844" misc_feature order(247..249,259..270,274..276,283..288,292..297, 304..309,349..357,484..486,493..504,586..594,598..603, 607..618,952..954,964..972) /gene="CDK2" /note="CDK/cyclin interface [polypeptide binding]; other site" /db_xref="CDD:270844" misc_feature order(286..288,400..402,517..519,523..525,580..582, 616..618,622..633,637..639,751..756) /gene="CDK2" /note="polypeptide substrate binding site [polypeptide binding]; other site" /db_xref="CDD:270844" misc_feature 568..639 /gene="CDK2" /note="activation loop (A-loop); other site" /db_xref="CDD:270844" exon 255..332 /gene="CDK2" /inference="alignment:Splign:2.1.0" exon 333..453 /gene="CDK2" /inference="alignment:Splign:2.1.0" exon 454..624 /gene="CDK2" /inference="alignment:Splign:2.1.0" exon 625..726 /gene="CDK2" /inference="alignment:Splign:2.1.0" exon 727..930 /gene="CDK2" /inference="alignment:Splign:2.1.0" exon 931..1991 /gene="CDK2" /inference="alignment:Splign:2.1.0" ORIGIN
ctgcgttccatcccgacctggggccgccgtgcagggccctgtttccccctcctcggcccccgagagctgggtgccgctttctgctgggttcccaggcccccgctccagggccgggctgattcgactcgctagcgcttcatggagaacttccaaaaagtggaaaagatcggagagggcacgtacggagttgtgtacaaagccaaaaacaaggtgacgggagaagtggtggcgcttaaaaaaatccgcctggacactgagacggagggtgtacccagtactgccattcgagagatctctctgcttaaggagcttaaccaccctaatattgtcaagttgctggatgtcattcacacagaaaacaaactctacctggtttttgagtttctgcaccaggatctcaagaaattcatggatgcctctgctctcactggcattcctcttcccctcataaagagttatctgttccagctgcttcaggggctagctttttgccattctcatcgggtcttgcaccgagaccttaaacctcagaatctgcttatcaacgcagaaggatctatcaagttagcagactttggactggccagagcctttggagtccctgttcgtacatacacccatgaggtggtgactttgtggtacagagcacctgaaatccttctgggctgcaaatactactctacagccgtggacatctggagcctgggctgcatctttgctgagatggtgacccgccgggctctgttccctggagattctgagattgaccagctcttccggatctttcggactctcgggaccccagatgaggtggtttggccaggagttacttccatgcctgattataaaccgagtttccctaagtgggccaggcaagattttagcaaagttgtgcctcccctggatgaagatggacggagcttgttatcgcaaatgctgcactacgaccccaacaagcggatttcagcaaaggcagctctggctcaccctttcttccaggatgtgaccaagccagtacctcaccttcgactttgatggcctttgtgaaccctacccctcgtctcaccctctcctccagtgggggcctgatctggcttggcccagggcttttagcccactgttcttgtctggctgccttagcactcacctgctcctctcagccagccaactttggagaaacagggggtagaggggagcaataggtgaaattgaaaggaagcttcagtactagatgcacttaagtcagcctccaccaccctccccccctcctcttagtcgttacttatgagagctggtatttaaaaaaaacaaaaaaaaagactgactctttctcctcccaccacacagggattgccatccagtctctgaaagcccagaaattattttctgtgtttgggagaccccaaatctcctgcagccattgcgtaaagctaactgataacagcggggctaagttggaacttttgaaacccaagcaaaacagaaacatagggagggacctgttttaaagaattaggttaaaaaaatagatccaaccagtttatgccctagttgtagtgtttcatctcacctaacagtctgggagattcaagactcccagtctctgcggtgctagtgaggcggcagtagaaatggttgctcctagtcttcttgcctgtccctcctacaggcaagaggtgtctgggacgctctgggacaaagacaatgcttcactgaggccttaagaggcaagtgaaaaatgtttgaatttttctcttccttttaagagtcttagttcatcaggtgctaagtcctatcttcctctgaaggccaccctcataagagtgaaagttaaggtttagacatcgttttgagaatgctgacacttttttagggctgtgactgagtgggggcgttggggaaaaaatatttctttaaaagaaggatgaacaattatatttatatttcaggttatagtagttttttaagtgggaatgggtggatttgttgcc
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]