GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2024-07-23 22:43:36, GGRNA.v2 : RefSeq release 224 (May, 2024)

LOCUS       NM_001247795            2763 bp    mRNA    linear   PLN 03-APR-2024
DEFINITION  Solanum lycopersicum Tm-1 protein (Tm-1), mRNA.
ACCESSION   NM_001247795 NM_001247615
VERSION     NM_001247795.2
KEYWORDS    RefSeq.
SOURCE      Solanum lycopersicum (Lycopersicon esculentum)
  ORGANISM  Solanum lycopersicum
            Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta;
            Spermatophyta; Magnoliopsida; eudicotyledons; Gunneridae;
            Pentapetalae; asterids; lamiids; Solanales; Solanaceae;
            Solanoideae; Solaneae; Solanum; Solanum subgen. Lycopersicon.
REFERENCE   1  (bases 1 to 2763)
  AUTHORS   Ishibashi,K., Naito,S., Meshi,T. and Ishikawa,M.
  TITLE     An inhibitory interaction between viral and cellular proteins
            underlies the resistance of tomato to nonadapted tobamoviruses
  JOURNAL   Proc Natl Acad Sci U S A 106 (21), 8778-8783 (2009)
   PUBMED   19423673
  REMARK    GeneRIF: Results suggest that an inhibitory interaction between the
            replication proteins and tm-1 underlies a multilayered resistance
            mechanism to TMGMV in tomato. [Tm-1]
REFERENCE   2  (bases 1 to 2763)
  AUTHORS   Ishibashi,K., Masuda,K., Naito,S., Meshi,T. and Ishikawa,M.
  TITLE     An inhibitor of viral RNA replication is encoded by a plant
            resistance gene
  JOURNAL   Proc Natl Acad Sci U S A 104 (34), 13833-13838 (2007)
   PUBMED   17699618
REFERENCE   3  (bases 1 to 2763)
  AUTHORS   Ohmori,T., Murata,M. and Motoyoshi,F.
  TITLE     Molecular characterization of RAPD and SCAR markers linked to the
            Tm-1 locus in tomato
  JOURNAL   Theor Appl Genet 92 (2), 151-156 (1996)
   PUBMED   24166161
COMMENT     VALIDATED REFSEQ: This record has undergone validation or
            preliminary review. The reference sequence was derived from
            AB287297.1 and AEKE03003138.1.
            
            On Nov 17, 2015 this sequence version replaced NM_001247795.1.
            
            ##Evidence-Data-START##
            Transcript exon combination :: AB287297.1 [ECO:0000332]
            RNAseq introns              :: single sample supports all introns
                                           SAMN06134382, SAMN06134383
                                           [ECO:0000348]
            ##Evidence-Data-END##
            COMPLETENESS: complete on the 3' end.
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-59                AB287297.1         1-59
            60-60               AEKE03003138.1     34831475-34831475   c
            61-2568             AB287297.1         61-2568
            2569-2569           AEKE03003138.1     34823628-34823628   c
            2570-2763           AB287297.1         2571-2764
FEATURES             Location/Qualifiers
     source          1..2763
                     /organism="Solanum lycopersicum"
                     /mol_type="mRNA"
                     /cultivar="Craigella"
                     /db_xref="taxon:4081"
                     /chromosome="2"
                     /map="2"
     gene            1..2763
                     /gene="Tm-1"
                     /gene_synonym="Tm-1^GCR237; tm-1^GCR26"
                     /note="Tm-1 protein"
                     /db_xref="GeneID:100134884"
     exon            1..332
                     /gene="Tm-1"
                     /gene_synonym="Tm-1^GCR237; tm-1^GCR26"
                     /inference="alignment:Splign:2.1.0"
     misc_feature    105..107
                     /gene="Tm-1"
                     /gene_synonym="Tm-1^GCR237; tm-1^GCR26"
                     /note="upstream in-frame stop codon"
     CDS             198..2462
                     /gene="Tm-1"
                     /gene_synonym="Tm-1^GCR237; tm-1^GCR26"
                     /note="protein p80(GCR237); disease resistance protein
                     Tm-1; ToMV susceptible protein tm-1(GCR26); Disease
                     susceptible protein tm-1; Protein p80(GCR26)"
                     /codon_start=1
                     /product="toMV resistance protein Tm-1(GCR237)"
                     /protein_id="NP_001234724.1"
                     /db_xref="GeneID:100134884"
                     /translation="
MATAQSNSPRVFCIGTADTKFDELRFLSEHVRSSLNSFSNKSSFKVGVTVVDVSTSRKETNSCADFDFVPSKDVLSCYARGEGTVGRFPDIRGQAIAIMNKALETFLSKANGEQNLAGVIGLGGSGGTSLLSSAFRSLPIGIPKVIISTVASGQTESYIGTSDLVLFPSVVDICGINNVSKVVLSNAGAAFAGMVIGRLESSKEHSITNGKFTVGVTMFGVTTPCVNAVKERLVKEGYETLVFHATGVGGRAMEDLVRGGFIQGVLDITTTEVADYVVGGVMACDSSRFDAILEKKIPLVLSVGALDMVNFGPKTTIPPEFQQRKIHQHNEQVSLMHTTVGENKKFAAFIAEKLNKASSSVCVCLPEKGVSALDAPGKDFYDPEATSCLTHELQMLLENNERCQVKVYPYHINDVEFANALVDSFLEMSPKSGHVECQTAESKSIQGIQNVNAVLEKYPSCNGKNFSRLNDFPNAKPETLQKRIVILQKLKDQISKGKPIIGAGAGTGISAKFEEAGGVDLIVLYNSGRFRMAGRGSLAGLLPFADANAIVLEMANEVLPVVKEVAVLAGVCATDPFRRMDNFLKQLESVGFCGVQNFPTVGLFDGNFRQNLEETGMGYGLEVEMIATAHRMGLLTTPYAFCPDEAVAMAEAGADIIVAHMGLTTSGSIGAKTAVSLEESVTCVQAIADATHRINPDAIVLCHGGPISSPEEAAYVLKRTTGVHGFYGASSMERLPVEQAITATVQQYKSISME"
     misc_feature    198..800
                     /gene="Tm-1"
                     /gene_synonym="Tm-1^GCR237; tm-1^GCR26"
                     /note="propagated from UniProtKB/Swiss-Prot (A7M6E8.1);
                     Region: N-terminal inhibitory domain NN.
                     /evidence=ECO:0000250|UniProtKB:A7M6E7"
     misc_feature    225..1481
                     /gene="Tm-1"
                     /gene_synonym="Tm-1^GCR237; tm-1^GCR26"
                     /note="Uncharacterized protein family (UPF0261); Region:
                     UPF0261; pfam06792"
                     /db_xref="CDD:429121"
     misc_feature    828..1490
                     /gene="Tm-1"
                     /gene_synonym="Tm-1^GCR237; tm-1^GCR26"
                     /note="propagated from UniProtKB/Swiss-Prot (A7M6E8.1);
                     Region: N-terminal inhibitory domain NC.
                     /evidence=ECO:0000250|UniProtKB:A7M6E7"
     misc_feature    1641..2456
                     /gene="Tm-1"
                     /gene_synonym="Tm-1^GCR237; tm-1^GCR26"
                     /note="Predicted TIM-barrel enzyme [Function unknown];
                     Region: COG5564"
                     /db_xref="CDD:444306"
     exon            333..986
                     /gene="Tm-1"
                     /gene_synonym="Tm-1^GCR237; tm-1^GCR26"
                     /inference="alignment:Splign:2.1.0"
     exon            987..1193
                     /gene="Tm-1"
                     /gene_synonym="Tm-1^GCR237; tm-1^GCR26"
                     /inference="alignment:Splign:2.1.0"
     exon            1194..1409
                     /gene="Tm-1"
                     /gene_synonym="Tm-1^GCR237; tm-1^GCR26"
                     /inference="alignment:Splign:2.1.0"
     exon            1410..1629
                     /gene="Tm-1"
                     /gene_synonym="Tm-1^GCR237; tm-1^GCR26"
                     /inference="alignment:Splign:2.1.0"
     exon            1630..1877
                     /gene="Tm-1"
                     /gene_synonym="Tm-1^GCR237; tm-1^GCR26"
                     /inference="alignment:Splign:2.1.0"
     exon            1878..2056
                     /gene="Tm-1"
                     /gene_synonym="Tm-1^GCR237; tm-1^GCR26"
                     /inference="alignment:Splign:2.1.0"
     exon            2057..2310
                     /gene="Tm-1"
                     /gene_synonym="Tm-1^GCR237; tm-1^GCR26"
                     /inference="alignment:Splign:2.1.0"
     exon            2311..2763
                     /gene="Tm-1"
                     /gene_synonym="Tm-1^GCR237; tm-1^GCR26"
                     /inference="alignment:Splign:2.1.0"
ORIGIN      
aaaaataaaaatggaacctctcctctgacggttgttgccgcctctctgtccaaccgttgccggtgatctttcatcgtcgagatttcagaaggctaacaactttctaatcttctcaccattctcacactgagttacactctatcttccattttgaaatctcgattgtaacacgaatagtagcagcttgtttgaggaaaatggcaactgcacagagtaattctcctcgagttttctgtatcggaacagctgatactaaattcgacgagcttcgtttcctctccgagcatgtgagatccagtcttaacagcttctccaataaatcctcattcaaggtaggagtgacagttgttgatgtctcaaccagccggaaggagacaaatagttgtgctgattttgattttgtaccgagtaaggatgtgctgtcatgctatgcacgaggggaaggaactgtgggcaggtttccagatattagaggccaagctattgcaatcatgaacaaagctctggaaactttcctaagtaaagctaatggtgaacagaatcttgctggagtgattggccttgggggtagtggaggaacatctctattgtcatctgccttccgatctcttccaattgggatcccaaaagttataatatctacagttgccagtggccaaactgaatcttatattggaacatcagacttggtattgtttccttcagttgtagatatttgtgggattaacaatgttagtaaggttgttctatctaatgcgggtgcagcatttgctggaatggtgattggaaggcttgaaagttcaaaagagcatagcatcactaatggaaagtttacagttggtgtaactatgtttggggttacgactccttgtgttaatgctgtcaaagaaagattagtgaaagaaggatatgagactttggtgttccatgccacgggtgtcgggggcagggccatggaggatcttgttagaggaggttttatacagggtgtgctggatattacgacaactgaggttgcagattacgtagttggaggagtaatggcatgtgatagttcccgatttgatgcaatattagagaagaaaattcctttggttctgagtgtgggagcactggatatggtgaattttggtcctaaaactaccatacctcctgagtttcagcaaagaaagattcatcaacataatgagcaggtttccctaatgcatactacagtaggtgaaaataagaaatttgctgcatttatagcagaaaagttgaacaaggcatcatcaagtgtatgtgtttgcttgccagagaaaggcgtgtctgcattggatgcacccgggaaagacttttatgatcctgaggcaactagttgtcttacacatgaactacagatgcttcttgaaaataatgaacgttgtcaggttaaggtctacccttaccatatcaatgatgtggagtttgcaaatgctttagttgattcatttttggaaatgtctccgaaatctggacacgtagaatgtcagacagctgagtccaaatctatacaaggcattcagaatgttaatgctgttctagagaaatatccctcatgcaacgggaaaaacttttctcgcctgaatgactttccaaatgcaaaaccagaaactttgcagaaaagaattgtgatactgcagaaattgaaagatcaaataagtaagggcaagcctattattggggctggtgctggtacaggtatttctgctaagtttgaggaagctggtggtgtagatttgattgtcttgtacaactcagggcgctttaggatggcaggaaggggatccttagctggtctattgccctttgctgatgcaaatgccattgtacttgagatggccaacgaagtattgcctgtggttaaggaagtggcagttctggctggagtttgtgctactgatcctttccgcaggatggacaacttcctgaagcagttggaatctgttggattctgtggggtgcaaaactttccaactgttggtctgtttgacggtaacttcagacaaaatttggaagagactggaatgggttatggcttggaggttgagatgattgcaacagctcataggatgggccttttgacaaccccatatgctttctgcccagatgaagcagttgctatggcagaagctggtgccgacatcatagttgctcatatggggcttacaacatctggttcaattggtgcaaaaacagctgtatcattggaggaaagtgtaacttgcgtccaagctattgcagatgctactcataggataaatcctgatgcaattgtgctctgccatggaggccctatatcttcccctgaagaagcagcatatgtactgaagagaaccacaggagttcatggattttatggcgcttcaagcatggaaagactaccagttgagcaagctataactgcaactgtccaacagtacaagtctatatctatggagtgagatgcaatggattttggttctttaaatgtccgaacctatatgtatggtcttcacctctttctttatatattactatcggtctcttgacttttgaaagaaattttttgtaacctgagattgatgatgcatacaatgggtccttggggtcgggcccttctctggaccttggcatagagggagctttagtgcaccgagctgtccctctgtctctgagagtaatgatgcagatcataagcattagctctttttttgtttgaatgttgtgttaatatgtcaatgaatctttctccagttatttttt
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]