GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2021-01-24 06:11:13, GGRNA.v2 : RefSeq release 203 (Nov, 2020)

LOCUS       NM_001199736            5177 bp    mRNA    linear   ROD 11-OCT-2020
DEFINITION  Mus musculus testis and ovary specific PAZ domain containing 1
            (Topaz1), mRNA.
ACCESSION   NM_001199736 XM_001474362 XM_001477413
VERSION     NM_001199736.2
KEYWORDS    RefSeq; RefSeq Select.
SOURCE      Mus musculus (house mouse)
  ORGANISM  Mus musculus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha;
            Muroidea; Muridae; Murinae; Mus; Mus.
REFERENCE   1  (bases 1 to 5177)
  AUTHORS   Luangpraseuth-Prosper A, Lesueur E, Jouneau L, Pailhoux E, Cotinot
            C and Mandon-Pepin B.
  TITLE     TOPAZ1, a germ cell specific factor, is essential for male meiotic
            progression
  JOURNAL   Dev Biol 406 (2), 158-171 (2015)
   PUBMED   26358182
  REMARK    GeneRIF: TOPAZ1, a germ cell specific factor, is essential for male
            meiotic progression.
REFERENCE   2  (bases 1 to 5177)
  AUTHORS   Baillet A, Le Bouffant R, Volff JN, Luangpraseuth A, Poumerol E,
            Thepot D, Pailhoux E, Livera G, Cotinot C and Mandon-Pepin B.
  TITLE     TOPAZ1, a novel germ cell-specific expressed gene conserved during
            evolution across vertebrates
  JOURNAL   PLoS One 6 (11), e26950 (2011)
   PUBMED   22069478
COMMENT     VALIDATED REFSEQ: This record has undergone validation or
            preliminary review. The reference sequence was derived from
            AC124778.4, HM631980.1 and BG075226.2.
            On Feb 12, 2019 this sequence version replaced NM_001199736.1.
            
            Sequence Note: This RefSeq record was created from transcript and
            genomic sequence data to make the sequence consistent with the
            reference genome assembly. The genomic coordinates used for the
            transcript record were based on transcript alignments.
            
            ##Evidence-Data-START##
            Transcript exon combination :: HM631980.1 [ECO:0000332]
            RNAseq introns              :: single sample supports all introns
                                           SAMN00849384 [ECO:0000348]
            ##Evidence-Data-END##
            
            ##RefSeq-Attributes-START##
            RefSeq Select criteria :: based on single protein-coding transcript
            ##RefSeq-Attributes-END##
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-147               AC124778.4         44035-44181         c
            148-5116            HM631980.1         1-4969
            5117-5177           BG075226.2         1-61                c
FEATURES             Location/Qualifiers
     source          1..5177
                     /organism="Mus musculus"
                     /mol_type="mRNA"
                     /strain="C57BL/6"
                     /db_xref="taxon:10090"
                     /chromosome="9"
                     /map="9"
     gene            1..5177
                     /gene="Topaz1"
                     /gene_synonym="671232; Gm9524"
                     /note="testis and ovary specific PAZ domain containing 1"
                     /db_xref="GeneID:671232"
                     /db_xref="MGI:MGI:3779933"
     exon            1..364
                     /gene="Topaz1"
                     /gene_synonym="671232; Gm9524"
                     /inference="alignment:Splign:2.1.0"
     misc_feature    127..129
                     /gene="Topaz1"
                     /gene_synonym="671232; Gm9524"
                     /note="upstream in-frame stop codon"
     CDS             148..5109
                     /gene="Topaz1"
                     /gene_synonym="671232; Gm9524"
                     /note="topaz 1; testis and ovary-specific PAZ domain gene
                     1; testis- and ovary-specific PAZ domain-containing
                     protein 1"
                     /codon_start=1
                     /product="protein TOPAZ1"
                     /protein_id="NP_001186665.1"
                     /db_xref="CCDS:CCDS57718.1"
                     /db_xref="GeneID:671232"
                     /db_xref="MGI:MGI:3779933"
                     /translation="
MRPPATPPDPTKEPGCKGTTRGLRKRGLPLTPEPGEGGGCSLEARGCEEESRQKQRMVTQASGREETEGDKLAKENGKITEAPSDDPQPGTDLVRKTSITSSESLQTVECSEFQNMAFLQSLDKEELGEGIKRRMRIKKCKSLENPPLEITKNEATQNIKVEFQDELFKNTPKHSCNSLSPGVEKNCSFELHDYSFLHSEGCNNENNFEDKPHDVCLHTEENSLKLKKENLRNLAEKDDTRTTTKLLKTEKSVIASKLLLEESHLYQNKNNGLTSCLQSEKNKYSVEENNTGRKHRKKMKSGKEEKNINLTLSNVCNNSVLVLQENQMGMEGKEAETLEPKKSFLKALRKINHNTLPPVDHLCLPKTVGKTSSRHHINAMLQKTLESSLKEDIKNTSESLGCKRIEPEKYNKSMISSTVKSPSDGHHMEKRSPRGDLRSETEESKVSCCRTIPMTGKRVWPFYSCARISAQCWKKTSLSDLNYSLLGPLENVRQHDSIIHQMNQTHLPDSKLLQPSLTERTTESSRKEMYDSDLSCLSSVSSVESTVMDIKEAMSHDKKTKLEEPSRNGAEVVSNATEDTQLSNITQSLTGNKKRKGNLSKLNLTVASQESQETNNCANKTVHRKVCITKQTLVAPDLVKILNTGRLTNFKIPLLKNKTGKRGAVSARSSEREAYSPLELLDSLSGVEAKQNRNKENICTTSGPQSLNLHSCIAPGQASSHSFYNKNSCTSSSFTKKGYDNKACNHISEPGNIISNKESISMKIENNTFSCDLGYIDQSSFCSKKQEAFVPISSEISGRKMTKSISELKLGFPDILKAYEDDVLLIDVIQDDPELFGISSEGDLSFASEVSKISQEPRVSEDQPTADFKHMHLPGKKEPGDLSKEVALLDPGLLKLESCPSLSAAKEPQHDPEGAAISLEATEETVVSGSLEGLSEQARASDSDAKCISSDKATVMEEQESTHEIFKSKDSRNVESATECQLATLGPNPLCSSALPVNLSSHQDVVSTPWINDVRFPGRHSVLQLQNPETCEIFKREKNMGVFQKPLGLLIPHRYCKLHFNTLRGCERAQCKFVHVPEQGDEKICMDVFRKYISVNEQRLLHRAAYIFLEYYRKFPPGIHFSLQVLNDLLISLLKHCLLKEVFQVVQLSIMAKMLPALKILLKIFEYVAAMKLRNAVPALIEIFCKFIEAGMVPDPEHLNYIVKLLHQAQASQQEISAVLQAKSRLRVRQLKKNWKCDLDSALSEVETCKEKSDWTKLGNLYISIKMSCEEFADLQRFCACVAETLTEDYKEERPGVPFCEFAETVSKDPQYSEVDKTLLGRIGISAVYFYHRLLLWAKGRKVLDILYELKIHFTSLKGLTGPEKEAPRCQIVNVAAEIFIKSGSLDGAIWVLRESEWIINTPLWPCDRMDVLNRHNLLCTIAHEILGKNLYKQTFEVLRNLPSFQNSQEMMGVSQSSLLFNELLDACIESNSLGISSSVAEFMVAKSIPIDFSFLRRLITSLGRSCLWLKARAHYKSALSLGCYPPLEGNLHRKLLLVPSYLSEIEMLLAMEIFLVSNASGIQSAGMGAPTQVLQIVLKRCEESKSRSKDEYQAAVERLVMAARISDPKLFIKHMTVNINKEQVYSLEHCSALKWLKENMKWAGKVWLFTNH"
     misc_feature    3712..4413
                     /gene="Topaz1"
                     /gene_synonym="671232; Gm9524"
                     /note="Putative aspartate racemase; Region:
                     Asp_Glu_race_2; pfam14669"
                     /db_xref="CDD:291341"
     exon            365..2795
                     /gene="Topaz1"
                     /gene_synonym="671232; Gm9524"
                     /inference="alignment:Splign:2.1.0"
     exon            2796..2860
                     /gene="Topaz1"
                     /gene_synonym="671232; Gm9524"
                     /inference="alignment:Splign:2.1.0"
     exon            2861..2985
                     /gene="Topaz1"
                     /gene_synonym="671232; Gm9524"
                     /inference="alignment:Splign:2.1.0"
     exon            2986..3050
                     /gene="Topaz1"
                     /gene_synonym="671232; Gm9524"
                     /inference="alignment:Splign:2.1.0"
     exon            3051..3184
                     /gene="Topaz1"
                     /gene_synonym="671232; Gm9524"
                     /inference="alignment:Splign:2.1.0"
     exon            3185..3270
                     /gene="Topaz1"
                     /gene_synonym="671232; Gm9524"
                     /inference="alignment:Splign:2.1.0"
     exon            3271..3396
                     /gene="Topaz1"
                     /gene_synonym="671232; Gm9524"
                     /inference="alignment:Splign:2.1.0"
     exon            3397..3460
                     /gene="Topaz1"
                     /gene_synonym="671232; Gm9524"
                     /inference="alignment:Splign:2.1.0"
     exon            3461..3612
                     /gene="Topaz1"
                     /gene_synonym="671232; Gm9524"
                     /inference="alignment:Splign:2.1.0"
     exon            3613..3705
                     /gene="Topaz1"
                     /gene_synonym="671232; Gm9524"
                     /inference="alignment:Splign:2.1.0"
     exon            3706..3821
                     /gene="Topaz1"
                     /gene_synonym="671232; Gm9524"
                     /inference="alignment:Splign:2.1.0"
     exon            3822..3888
                     /gene="Topaz1"
                     /gene_synonym="671232; Gm9524"
                     /inference="alignment:Splign:2.1.0"
     exon            3889..4063
                     /gene="Topaz1"
                     /gene_synonym="671232; Gm9524"
                     /inference="alignment:Splign:2.1.0"
     exon            4064..4164
                     /gene="Topaz1"
                     /gene_synonym="671232; Gm9524"
                     /inference="alignment:Splign:2.1.0"
     exon            4165..4330
                     /gene="Topaz1"
                     /gene_synonym="671232; Gm9524"
                     /inference="alignment:Splign:2.1.0"
     exon            4331..4495
                     /gene="Topaz1"
                     /gene_synonym="671232; Gm9524"
                     /inference="alignment:Splign:2.1.0"
     exon            4496..4699
                     /gene="Topaz1"
                     /gene_synonym="671232; Gm9524"
                     /inference="alignment:Splign:2.1.0"
     exon            4700..4889
                     /gene="Topaz1"
                     /gene_synonym="671232; Gm9524"
                     /inference="alignment:Splign:2.1.0"
     exon            4890..5177
                     /gene="Topaz1"
                     /gene_synonym="671232; Gm9524"
                     /inference="alignment:Splign:2.1.0"
ORIGIN      
gacttccgcttcctgtagtgtcgggtacagggtcggaagcgaggccaggccgggccagggtgggcagtagcctgtgtcctgcagggggagcagcggctctaggccgtctaggcttcccagagaggctgagtgggcggctgtgggcggatgcggccgccagcgacgcccccagacccgaccaaggagccagggtgcaaaggcaccacccgaggcctgaggaagcgaggccttccgctgacgccagagccaggcgaggggggaggctgcagcctggaggccagggggtgcgaggaggagagcaggcagaagcagaggatggtgacccaggcttctgggagagaagagacagaaggtgacaagttggccaaagagaatggaaaaattactgaggccccaagtgatgatccacagccagggactgacctggtaagaaagacatcaataaccagttcggagtctttgcaaacagtggagtgcagtgaatttcaaaatatggctttcttacagtctttggataaggaagaattgggagaaggtattaaaagaagaatgcgaattaaaaaatgtaaaagtttagaaaatccacctcttgaaataactaaaaatgaggcaacacaaaatattaaagttgaattccaagatgaactgttcaagaataccccaaaacattcttgtaacagcttatcacctggagtagaaaaaaattgcagctttgaattgcatgattacagttttctccattctgaaggttgtaataatgaaaacaactttgaggataaacctcatgatgtatgtctacacactgaagagaactctttgaagttaaagaaagaaaaccttaggaatcttgcagagaaagatgacacaagaactactactaagcttttaaaaactgaaaaaagtgtaatagccagtaagttactgcttgaagaaagtcatttataccaaaataaaaacaatggcttgacttcttgccttcaaagtgaaaaaaacaaatattcagtagaggagaacaacactgggagaaaacacaggaaaaaaatgaagtctggaaaagaagaaaaaaatattaatcttactttgtctaatgtatgtaacaattctgtgttggtgttacaagaaaaccaaatgggtatggaagggaaagaagcagagaccttagaacctaaaaaaagttttctaaaagctttaagaaaaataaaccataatacactccctccggtggaccatttgtgtctccccaaaacagtggggaaaacaagttctaggcatcacataaatgctatgcttcagaaaaccctcgaatcaagtttgaaagaggatataaaaaatacttcagagtccttaggatgcaaacgtatagagccagaaaaatataataaatcgatgataagctctacagtgaaatcacctagtgacggccatcatatggaaaagagatctccacggggagatctgagaagtgaaactgaagagtcaaaggttagctgttgcagaacaataccaatgactggtaaaagagtttggcctttttattcttgtgctagaatatctgcccagtgttggaaaaagacttccttgtcagatttaaattactcacttctggggccactggaaaatgttaggcaacatgattctataatacaccaaatgaaccagactcacttacctgactctaaactgttacaaccatccttaacagaaagaactactgagtcctcaagaaaagaaatgtatgattctgatttaagttgtttgtcttcagtttcttcagtagaatctactgtgatggatataaaggaagctatgtcccatgataaaaagacaaagttagaggaacccagcagaaatggggcagaggtagtttctaatgcaactgaagacacccagttaagtaatataactcaaagcttaacaggaaataagaaaaggaaagggaatttatcaaaacttaatttaacagttgcatcccaagagagccaggaaacaaataactgtgcaaataaaactgttcatcgaaaagtttgtattactaagcaaacacttgtggcaccggacttggttaaaatattaaacacgggacggctgactaattttaaaatccctttactaaagaacaagacaggaaaaagaggagcagtaagtgccaggtcatctgagagagaagcttatagccccctagagctacttgacagtttatctggagtagaggcaaaacaaaataggaataaggaaaatatctgtacaacttcaggaccacagtctttgaatttacatagttgtatagctccagggcaagctagttctcattcattctacaataagaattcctgtacttcttcgagctttaccaagaaaggttacgataataaagcatgtaatcacatctctgaaccaggaaatattatttcaaataaggagtctatttctatgaaaattgaaaataataccttttcttgtgatcttggatatattgatcaaagttccttctgctctaagaaacaagaagcatttgtgccaatttcctctgaaattagtggtagaaaaatgactaaaagcatttcagaactcaaattggggtttccagatattcttaaagcatatgaagatgatgtcctcttgattgatgtaattcaagatgatccagagctctttggaatctccagtgagggggatctttcctttgcttcagaagtctccaagataagccaggagcccagagtatctgaagaccaaccaacagcagattttaagcacatgcaccttccagggaaaaaagaaccaggcgatttgagtaaagaagttgccttgctggaccctggattgctgaaactggagagctgtccttccttgtcagcagcaaaggagcctcagcatgatcctgaaggagcagccatctccttagaagccactgaggagactgttgtaagtggaagcctagaaggcctcagtgaacaagcgcgggcttcagactcagacgcgaagtgcataagttcagacaaggcaaccgttatggaagaacaagagagtactcatgaaattttcaaaagcaaagattctagaaatgtggagtcagctactgagtgtcagttagcaacactgggccccaaccctctgtgctcatcagcacttcctgtgaatctaagcagtcatcaagatgtagtgtcaacaccctggataaatgatgtcagatttccaggaagacattctgtcctacaactgcagaaccctgaaacttgtgaaatatttaaaagagaaaaaaacatgggggtgttccagaagcccttagggttgttgataccccacagatactgcaaacttcattttaacacattgcgtggctgtgagcgagcacagtgcaagtttgtccatgtgcctgagcagggggatgagaagatctgcatggatgtgtttaggaaatacataagtgtcaatgagcagcgtttgctgcatcgagcagcatacatatttctggagtactacagaaagtttcccccagggatacacttcagtttacaagtgctaaatgaccttttgatttctttactcaagcattgtttattgaaagaagtcttccaggtagtgcagctcagcataatggctaaaatgctgcctgctctgaaaatattactaaaaatatttgagtatgtggcagctatgaagttgaggaatgctgtacctgctttaattgagattttttgcaagttcattgaagctgggatggtacctgacccagagcacttgaactatattgttaagcttttacatcaagcacaggcatcccaacaagaaatatctgcagttctgcaagccaaatccaggttgcgagtgaggcagctgaaaaagaactggaagtgtgacttagactcagccttgagtgaagtagagacttgtaaagaaaaaagtgactggaccaaattgggaaacctgtacattagcataaagatgagttgtgaagaatttgcagatctgcagagattctgtgcttgtgttgctgagacgctcacagaagattacaaagaagagaggccaggcgttcctttttgtgaatttgctgaaacagttagcaaagatccacagtacagtgaggtggataagactttgttgggaaggatcggaataagtgcggtgtacttctatcacagactgttgctgtgggccaagggaaggaaggtcttagatatattatatgagctaaaaatacatttcacaagtttaaaaggacttacaggacctgaaaaagaagcaccaagatgtcaaattgtaaatgttgcagcagagatttttatcaaaagtgggagcctagatggtgccatttgggtcctaagggaatcggaatggataatcaacacaccactttggccttgtgatagaatggatgtgcttaatcggcataatttgctctgtaccattgcacatgaaatcttgggcaagaatctttacaaacaaacatttgaggtcttacggaatctaccaagctttcagaattctcaagaaatgatgggggtttcccagtccagccttctttttaatgaacttctggatgcctgtatagaaagtaacagtcttggcatatcgtcttctgtagcagagttcatggttgccaagagcatccctattgacttttcctttctcaggagactcatcacttccttaggaaggagttgtttgtggctcaaagccagagcccactacaaaagtgctctttcactgggttgctacccaccattagagggaaacttacaccggaaacttctcctggttccttcgtatctatctgagattgaaatgcttttagctatggaaatatttctggtgtccaatgctagtggcattcagagtgcaggaatgggagcgcccacacaggtgctgcagattgtcctgaaaagatgtgaagaaagcaaatctcgaagcaaggatgaatatcaagctgcagtagaaagattggtcatggctgctcgaatatcggaccccaagcttttcattaagcacatgactgtcaatattaacaaggagcaggtgtacagtctggagcactgttctgctttgaaatggctgaaagagaatatgaagtgggctggaaaggtttggcttttcactaaccattagtaaagggttgttgttgcattttctttttaagttcaaataatcattgttgaaaataaaagaataaaaat
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]