2025-09-17 13:27:02, GGRNA.v2 : RefSeq release 231 (Jul, 2025)
LOCUS NM_001193829 654 bp mRNA linear PRI 03-APR-2025 DEFINITION Macaca mulatta claudin 9 (CLDN9), mRNA. ACCESSION NM_001193829 XM_001088610 VERSION NM_001193829.2 KEYWORDS RefSeq. SOURCE Macaca mulatta (Rhesus monkey) ORGANISM Macaca mulatta Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini; Catarrhini; Cercopithecidae; Cercopithecinae; Macaca. REFERENCE 1 (bases 1 to 654) AUTHORS Yan,G., Zhang,G., Fang,X., Zhang,Y., Li,C., Ling,F., Cooper,D.N., Li,Q., Li,Y., van Gool,A.J., Du,H., Chen,J., Chen,R., Zhang,P., Huang,Z., Thompson,J.R., Meng,Y., Bai,Y., Wang,J., Zhuo,M., Wang,T., Huang,Y., Wei,L., Li,J., Wang,Z., Hu,H., Yang,P., Le,L., Stenson,P.D., Li,B., Liu,X., Ball,E.V., An,N., Huang,Q., Zhang,Y., Fan,W., Zhang,X., Li,Y., Wang,W., Katze,M.G., Su,B., Nielsen,R., Yang,H., Wang,J., Wang,X. and Wang,J. TITLE Genome sequencing and comparison of two nonhuman primate animal models, the cynomolgus and Chinese rhesus macaques JOURNAL Nat Biotechnol 29 (11), 1019-1023 (2011) PUBMED 22002653 REMARK Publication Status: Online-Only COMMENT INFERRED REFSEQ: This record is predicted by genome sequence analysis and is not yet supported by experimental evidence. The reference sequence was derived from QNVO02000290.1. On Dec 12, 2019 this sequence version replaced NM_001193829.1. Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments. PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP 1-654 QNVO02000290.1 27410709-27411362 c FEATURES Location/Qualifiers source 1..654 /organism="Macaca mulatta" /mol_type="mRNA" /db_xref="taxon:9544" /chromosome="20" /map="20" gene 1..654 /gene="CLDN9" /gene_synonym="Claudin-9" /note="claudin 9" /db_xref="GeneID:699721" CDS 1..654 /gene="CLDN9" /gene_synonym="Claudin-9" /codon_start=1 /product="claudin-9" /protein_id="NP_001180758.1" /db_xref="GeneID:699721" /translation="
MASTGLELLGMTLAVLGWLGTLVSCALPLWKVTAFIGNSIVVAQVVWEGLWMSCVVQSTGQMQCKVYDSLLALPQDLQAARALCVIALLLALLGLLLAITGAQCTTCVEDEGAKARIMLTAGVILLLAGILVLIPVCWTAHAIIQDFYNPLVAEALKRELGASLYLGWAAAALLMLGGGLLCCTCPPPQVERPRGPRLGYSIPSRSGASGLDKRDYV"
misc_feature 10..489 /gene="CLDN9" /gene_synonym="Claudin-9" /note="PMP-22/EMP/MP20/Claudin family; Region: PMP22_Claudin; cl21598" /db_xref="CDD:473919" exon 1..654 /gene="CLDN9" /gene_synonym="Claudin-9" /inference="alignment:Splign:2.1.0" ORIGIN
atggcttcgactggcttagaactgctgggcatgaccctggctgtgctgggctggctggggaccctggtgtcctgtgccctgcccctgtggaaggtgaccgccttcatcggcaacagcatcgtagtggcccaggtggtgtgggaggggctgtggatgtcctgcgtggtgcagagcacgggccagatgcagtgcaaggtgtacgactcgctgctggcactgccacaggacctgcaggctgcacgtgccctctgtgtcatcgccctcctgctggccctgcttggcctcctgttggccatcacaggtgcccagtgtaccacatgtgtggaggatgaaggtgccaaggcccgtatcatgctcaccgcgggagtcatcctcctcctcgctggcatcctggtgctcatccctgtgtgctggacggcgcacgccatcatccaggacttctacaaccccctggtggctgaggccctcaagcgggagctgggagcctccctctacctgggctgggcggcagccgcactgcttatgctgggcggggggctcctctgctgcacgtgccccccgccccaggtcgagcggccccgtggaccgaggctgggctactccatcccctcccgctcaggcgcgtctggactggacaagagggactacgtgtga
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]