GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2024-04-27 08:08:25, GGRNA.v2 : RefSeq release 222 (Jan, 2024)

LOCUS       NM_001161635            1012 bp    mRNA    linear   MAM 19-FEB-2022
DEFINITION  Sus scrofa claudin 1-like (LOC396566), mRNA.
ACCESSION   NM_001161635
VERSION     NM_001161635.1
KEYWORDS    RefSeq.
SOURCE      Sus scrofa (pig)
  ORGANISM  Sus scrofa
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Laurasiatheria; Artiodactyla; Suina; Suidae;
            Sus.
REFERENCE   1  (bases 1 to 1012)
  AUTHORS   Martin-Martin N, Ryan G, McMorrow T and Ryan MP.
  TITLE     Sirolimus and cyclosporine A alter barrier function in renal
            proximal tubular cells through stimulation of ERK1/2 signaling and
            claudin-1 expression
  JOURNAL   Am. J. Physiol. Renal Physiol. 298 (3), F672-F682 (2010)
   PUBMED   19955189
  REMARK    GeneRIF: Cyclosporine A/sirolimus alter claudin-1 expression in
            renal proximal tubular cells via ERK1/2 signaling pathway to alter
            barrier function.
COMMENT     PROVISIONAL REFSEQ: This record has not yet been subject to final
            NCBI review. The reference sequence was derived from FJ873109.1.
            
            ##Evidence-Data-START##
            Transcript exon combination :: FJ873109.1 [ECO:0000332]
            ##Evidence-Data-END##
FEATURES             Location/Qualifiers
     source          1..1012
                     /organism="Sus scrofa"
                     /mol_type="mRNA"
                     /db_xref="taxon:9823"
                     /chromosome="8"
                     /map="8"
     gene            1..1012
                     /gene="LOC396566"
                     /note="claudin 1-like"
                     /db_xref="GeneID:396566"
     exon            1..1012
                     /gene="LOC396566"
                     /inference="alignment:Splign:2.1.0"
     misc_feature    34..36
                     /gene="LOC396566"
                     /note="upstream in-frame stop codon"
     CDS             175..810
                     /gene="LOC396566"
                     /codon_start=1
                     /product="claudin-1-like"
                     /protein_id="NP_001155107.1"
                     /db_xref="GeneID:396566"
                     /translation="
MANAGLQLLGFILAFLGWIGSIVSTALLQWKIYSYAGDNIVTAQAIYEGLWMSCVSQSTGQIQCKVFDSLLNLNSTLQATRALMVIGILLGLIAIFVATVGMKCMKCMEDDEVQKMRMAVIGGVIFLISGLAILVATARYGNRIVQEFYHLMTPVNARYEFGQALFTGWAAASLCLLGGALLCRSCPRKTTSYPTPRPYPKPSPSSGKDYV"
     misc_feature    187..693
                     /gene="LOC396566"
                     /note="PMP-22/EMP/MP20/Claudin family; Region:
                     PMP22_Claudin; cl21598"
                     /db_xref="CDD:451326"
ORIGIN      
tcttgcttctcaacttcagcgcccacccggccctagacccacacccctcgcatcaccacctgcagcccccgcgcggcgccgccacccccgggagtcctgggtgggcacctgcaaactccgccttgtgcacctgcggcccttgagccggtgctagcgcctgatcgagccagagctatggccaacgcggggctgcagctgctgggcttcatcctggccttcctgggctggatcggctccatcgtcagcaccgcactgcttcagtggaagatttactcctacgctggtgacaacattgtgacggcccaggccatctacgaggggctgtggatgtcctgcgtgtcgcagagcaccgggcagatccagtgcaaagtcttcgactccttgctgaatctgaacagcactttgcaagcaacccgtgccttgatggtaattggcatcctgctgggactaatagccatctttgtggccactgttggcatgaagtgtatgaagtgcatggaagatgatgaggtgcagaagatgcggatggctgtcattgggggagtgatctttcttatttcaggtctggctatcttagttgccacagcaaggtatggtaacagaattgttcaagaattctatcacctcatgaccccggtcaatgccagatatgaatttggtcaggctctcttcactggctgggctgctgcttctctctgccttctgggaggtgccctactttgccgctcctgtccccgaaaaacaacatcttacccaacaccaaggccctatccaaaaccttcgccttccagtgggaaagactacgtgtgacacagaatcaaaaggacaaaaccgtgtgggaacaaccagaaaatggacattgaaatactgtcattgacactgagatcttcgacttttgactgttagagtctgaactatggtataaccaaaaaaatattatttttttaaaatacacattgctaaaaatgatgaggtcttattttatctcctttcctcaatacgggagggaagc
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]