2024-03-28 19:37:25, GGRNA.v2 : RefSeq release 222 (Jan, 2024)
LOCUS NM_001160075 790 bp mRNA linear MAM 19-FEB-2022 DEFINITION Sus scrofa claudin 3 (CLDN3), mRNA. ACCESSION NM_001160075 VERSION NM_001160075.1 KEYWORDS RefSeq. SOURCE Sus scrofa (pig) ORGANISM Sus scrofa Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Laurasiatheria; Artiodactyla; Suina; Suidae; Sus. COMMENT PROVISIONAL REFSEQ: This record has not yet been subject to final NCBI review. The reference sequence was derived from FJ887981.1. ##Evidence-Data-START## Transcript exon combination :: FJ887981.1, SRR5120059.338887.1 [ECO:0000332] RNAseq introns :: single sample supports all introns SAMEA103886120, SAMEA103886124 [ECO:0000348] ##Evidence-Data-END## FEATURES Location/Qualifiers source 1..790 /organism="Sus scrofa" /mol_type="mRNA" /db_xref="taxon:9823" /chromosome="3" /map="3" gene 1..790 /gene="CLDN3" /note="claudin 3" /db_xref="GeneID:431781" exon 1..487 /gene="CLDN3" /inference="alignment:Splign:2.1.0" CDS 143..568 /gene="CLDN3" /codon_start=1 /product="claudin-3" /protein_id="NP_001153547.1" /db_xref="GeneID:431781" /translation="
MSMGLEIAGTSLAVMGWLSTIVCCALPMWRVTAFIGSSIITARITWEGLWMNCVVQSTGQMQCKVYDSLLALPQDLQAARALIVVAILLAAFGLLVALVGAQCTNCVQDDTAKAKILYSAPRSTVGPGTGTGTAYDRKDYV"
misc_feature 149..>472 /gene="CLDN3" /note="PMP-22/EMP/MP20/Claudin family; Region: PMP22_Claudin; cl21598" /db_xref="CDD:451326" exon 488..790 /gene="CLDN3" /inference="alignment:Splign:2.1.0" ORIGIN
tcctcgtgtccgtctatccgtccgtccgtcggggcgtccatccagcggcgcagagccgttcgcaaccaggccccagcggccccggcccctcgtcgtcccgcacccggagctgcccggccgagccggctttggagcagcagccatgtccatgggcctggagatcgcgggcacctcgctagccgtcatgggctggctgagcaccatcgtgtgctgcgcgctgcccatgtggcgcgtcacggccttcatcggcagcagcattatcacagcgcggatcacctgggagggcctgtggatgaactgcgtggtgcagagcacgggccagatgcagtgcaaagtgtacgactctctgctggcgctgccgcaggacctgcaggcggcccgcgccctcatcgtcgtcgccatcctgctggccgcctttgggctccttgtggcgcttgtgggcgcccagtgcaccaactgcgtgcaggacgacacggccaaagccaagatcctctactccgcgccgcgctccaccgtcgggccgggcaccggcaccggcacggcctacgaccgcaaggactacgtatgagggggcagccgcggagagtccccaccacccccacgagctcgtgcgcccaccagtcctccgtgcggccttgcatccgagaccagtccacccagatgctaggcagctctctcgccggactgggaggggcccgcccggtgtcaccctccccagctgccacccctcctcgggccggggagcgggattgcggagcccagagaccagtcagcacggaccatgaaacct
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]