GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2020-12-06 00:28:27, GGRNA.v2 : RefSeq release 202 (Sep, 2020)

LOCUS       NM_001112448            2974 bp    mRNA    linear   PLN 02-JUL-2020
DEFINITION  Zea mays HOX1B protein (LOC732843), mRNA.
ACCESSION   NM_001112448 XM_020539216
VERSION     NM_001112448.2
KEYWORDS    RefSeq.
SOURCE      Zea mays
  ORGANISM  Zea mays
            Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta;
            Spermatophyta; Magnoliopsida; Liliopsida; Poales; Poaceae; PACMAD
            clade; Panicoideae; Andropogonodae; Andropogoneae; Tripsacinae;
            Zea.
REFERENCE   1  (bases 1 to 2974)
  AUTHORS   Uberlacker B, Klinge B and Werr W.
  TITLE     Ectopic expression of the maize homeobox genes ZmHox1a or ZmHox1b
            causes pleiotropic alterations in the vegetative and floral
            development of transgenic tobacco
  JOURNAL   Plant Cell 8 (3), 349-362 (1996)
   PUBMED   8721746
COMMENT     VALIDATED REFSEQ: This record has undergone validation or
            preliminary review. The reference sequence was derived from
            LPUQ01002925.1, FL194104.1 and EB403344.1.
            On or before Jun 14, 2017 this sequence version replaced
            XM_020539216.1, NM_001112448.1.
            
            ##Evidence-Data-START##
            Transcript exon combination :: SRR3147053.9992.1, SRR3147023.9814.1
                                           [ECO:0000332]
            RNAseq introns              :: single sample supports all introns
                                           SAMN01096209 [ECO:0000348]
            ##Evidence-Data-END##
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-74                LPUQ01002925.1     525257-525330       c
            75-214              FL194104.1         53-192
            215-714             LPUQ01002925.1     507662-508161       c
            715-880             LPUQ01002925.1     506814-506979       c
            881-1004            LPUQ01002925.1     506583-506706       c
            1005-1117           LPUQ01002925.1     506393-506505       c
            1118-1345           LPUQ01002925.1     506088-506315       c
            1346-2098           EB403344.1         1-753
            2099-2974           LPUQ01002925.1     503323-504198       c
FEATURES             Location/Qualifiers
     source          1..2974
                     /organism="Zea mays"
                     /mol_type="mRNA"
                     /cultivar="B73"
                     /db_xref="taxon:4577"
                     /chromosome="6"
                     /map="6"
     gene            1..2974
                     /gene="LOC732843"
                     /gene_synonym="GRMZM2G094935; homeobox2; Hox1b"
                     /note="HOX1B protein"
                     /db_xref="GeneID:732843"
     exon            1..127
                     /gene="LOC732843"
                     /gene_synonym="GRMZM2G094935; homeobox2; Hox1b"
                     /inference="alignment:Splign:2.1.0"
     exon            128..714
                     /gene="LOC732843"
                     /gene_synonym="GRMZM2G094935; homeobox2; Hox1b"
                     /inference="alignment:Splign:2.1.0"
     misc_feature    242..244
                     /gene="LOC732843"
                     /gene_synonym="GRMZM2G094935; homeobox2; Hox1b"
                     /note="upstream in-frame stop codon"
     CDS             254..2332
                     /gene="LOC732843"
                     /gene_synonym="GRMZM2G094935; homeobox2; Hox1b"
                     /note="putative homeodomain-like transcription factor
                     superfamily protein"
                     /codon_start=1
                     /product="HOX1B protein"
                     /protein_id="NP_001105918.2"
                     /db_xref="GeneID:732843"
                     /translation="
MEKKTVHVPAEGNGEIENGTSSSQNPETLEHPVLLSASQTVPNNLGIRKNYKRAANRGKKGSQGLTGQAYTLRSSDIDVRVLRSTSGSKTTSTEHVQPPGQPAAKRRKRSRASNKNSTDEFSQIRKRVRYILNRMNYEQSLIEAYASEGWKNQSLDKIRPEKELERAKSEILRCKLRIREVFQNIDSLLSKGKIDESLFDSEGEISCEDIFCATCGSKNATLGNDIILCDGACDRGFHQNCLNPPLRTEDIPMGDEGWLCPACDCKLDCIDLINELQGSDISIEDPWEKVFPEAAAMANSSKQDEAFDLPSDDSDDNDFDPNMPEEHVASKEEGSSEEEEDDDGGSDSDDSDFLTCSDDLEPLIDKKNVDDLGLPSEDSEDDDYDPAGPDSDKDVEKKSNSDESDFMSDSDDFCKEIKKSGGHDEVSSPPLPDVKVGDMEKNTAQSNTTSSADDPMETEIDQSVVLPVSRRRQAERLDYKRLYDEAYGEASSDSSDEEEWSGKNTPIKSNEEGEVGSPAGKGSRVAHHNELTTQNTKESLHSLHGSVDEKHGDLTSNGSNIKDRKGHFGPVISQKLHEHFKTQPYPSRSLKESLAEELGLTFHQVNRWFENRRHFARLASSRKGISPDKHSPQNTNSPVTPSMQPKEPEGTVMEESNVCINRDATISKKAVSSKVGSRKNLSKSSPKSRVRS"
     misc_feature    884..1042
                     /gene="LOC732843"
                     /gene_synonym="GRMZM2G094935; homeobox2; Hox1b"
                     /note="PHD finger found in Arabidopsis thaliana
                     pathogenesis-related homeodomain protein (PRHA) and
                     similar proteins; Region: PHD_PRHA_like; cd15504"
                     /db_xref="CDD:276979"
     misc_feature    order(884..886,926..940,953..955,1025..1027)
                     /gene="LOC732843"
                     /gene_synonym="GRMZM2G094935; homeobox2; Hox1b"
                     /note="putative histone H3 binding site [polypeptide
                     binding]; other site"
                     /db_xref="CDD:276979"
     misc_feature    order(887..889,896..898,938..940,950..952,965..967,
                     974..976,1031..1033,1040..1042)
                     /gene="LOC732843"
                     /gene_synonym="GRMZM2G094935; homeobox2; Hox1b"
                     /note="Zn binding site [ion binding]; other site"
                     /db_xref="CDD:276979"
     misc_feature    1943..2092
                     /gene="LOC732843"
                     /gene_synonym="GRMZM2G094935; homeobox2; Hox1b"
                     /note="Homeodomain; Region: HOX; smart00389"
                     /db_xref="CDD:197696"
     misc_feature    order(1943..1945,1952..1954,2072..2074,2081..2086)
                     /gene="LOC732843"
                     /gene_synonym="GRMZM2G094935; homeobox2; Hox1b"
                     /note="specific DNA base contacts [nucleotide binding];
                     other site"
                     /db_xref="CDD:238039"
     exon            715..880
                     /gene="LOC732843"
                     /gene_synonym="GRMZM2G094935; homeobox2; Hox1b"
                     /inference="alignment:Splign:2.1.0"
     exon            881..1004
                     /gene="LOC732843"
                     /gene_synonym="GRMZM2G094935; homeobox2; Hox1b"
                     /inference="alignment:Splign:2.1.0"
     exon            1005..1117
                     /gene="LOC732843"
                     /gene_synonym="GRMZM2G094935; homeobox2; Hox1b"
                     /inference="alignment:Splign:2.1.0"
     exon            1118..1705
                     /gene="LOC732843"
                     /gene_synonym="GRMZM2G094935; homeobox2; Hox1b"
                     /inference="alignment:Splign:2.1.0"
     exon            1706..1975
                     /gene="LOC732843"
                     /gene_synonym="GRMZM2G094935; homeobox2; Hox1b"
                     /inference="alignment:Splign:2.1.0"
     exon            1976..2065
                     /gene="LOC732843"
                     /gene_synonym="GRMZM2G094935; homeobox2; Hox1b"
                     /inference="alignment:Splign:2.1.0"
     exon            2066..2974
                     /gene="LOC732843"
                     /gene_synonym="GRMZM2G094935; homeobox2; Hox1b"
                     /inference="alignment:Splign:2.1.0"
ORIGIN      
ccgccgcttcgctcacgcggccacgcctcccgctcttcctccccgccacactcgccccacgcaggagaggaggagagccgccgggcctggaagcttctccgcggcgctgcgtcgccagctcgcagcgatttcaaggtgctggtgaatctggcttggccacatagatcttttttattgttgtcctcagaagacaggtttgctgagactgctttctgtctactgtaaattgatgaaattttggtgatcatatactatggaaaaaaagacagttcacgttccggctgagggtaatggtgagattgaaaatggtacgagctctagtcagaatcctgagacccttgagcatccagttttgctgtctgcatctcaaactgtgccaaataacttggggataaggaaaaactataaaagggcagcaaacagaggtaaaaagggttcccaaggactaacaggtcaggcatatactttgaggtcatctgatattgatgtcagggtgcttcgctctacatcaggttcaaagacaacatctactgagcatgtgcagcctccaggacaaccagctgccaagagaagaaaaaggagcagagcctcaaacaaaaattcgacagatgagttctcacaaattcgtaaacgggttagatacattttgaaccgaatgaattatgagcaaagcctaattgaagcttatgctagtgaaggctggaaaaatcaaagtttggataagataagacctgagaaggagcttgaacgagccaaatcagaaatcttacgatgcaaattgagaatacgggaagtcttccaaaatattgattctcttctatccaaggggaaaattgacgaatctttatttgattctgaaggagaaatatcttgtgaagatatcttttgtgctacttgtggttcgaaaaatgctacattgggtaatgatatcattctctgtgatggagcttgtgacagagggttccaccagaactgtctaaatcctcctctgcgtactgaagatattcccatgggagatgaaggatggctctgcccagcatgtgattgcaagttagactgtatagatctaataaatgaactccagggcagtgacatctccattgaggacccttgggagaaagtttttccagaggcagctgctatggccaatagctctaagcaagatgaagcatttgatcttccatctgatgattcggatgacaatgattttgaccccaatatgcctgaagagcatgtggctagtaaggaagaaggatcttctgaagaggaagaggatgatgacggaggatcagactctgacgactctgacttcttaacctgttctgatgatttggaacctttgatagataaaaagaatgttgatgacctgggattaccttctgaagattcagaggatgatgactatgatccagcaggtcctgattcggataaagatgtcgaaaagaagtcaaattctgatgagtctgatttcatgtctgactcggatgatttttgtaaggagattaaaaaatctggtggacatgatgaagtttcatcgcctccattacccgatgtcaaggtgggtgatatggaaaagaacactgctcagtctaacacaacaagttctgctgacgaccctatggagactgaaatagaccagagtgtggttttaccagtatcaaggaggcgtcaagctgaacggttggactacaaaaggctgtatgatgaggcatatggtgaagcatcatctgattctagtgatgaagaagaatggtctgggaagaacacaccaataaaaagcaatgaagagggtgaagttggttctcctgcaggaaaaggctctagagttgcgcaccataatgaactgactacacaaaacactaaagaaagcttgcattctcttcatggttcagtagatgagaaacatggagatcttacttctaatggcagcaatatcaaagataggaaaggacattttggtccagtgattagtcagaagctacatgaacattttaagacacaaccataccctagtcgttctcttaaagaaagcttggcagaagaactagggctaacatttcatcaggtcaacagatggtttgaaaataggcgtcattttgcaaggttagcttcttccaggaaaggcatcagtccagataagcatagcccccaaaatactaatagcccagtgacacctagtatgcaacctaaagaaccagaggggactgtgatggaagaatctaatgtatgcataaacagggatgctaccatctctaaaaaagcggtttcttcaaaagtcggatcaagaaagaaccttagcaagagttcccctaaaagccgggtcagaagttgattctgccgcggatcagaatctgtggcctgaccttacagagaaggcagggcaggcaaaaagcaatacagcaggagttgaagaagaaaatgggacgatgaagtttgtagacaaagacatgagccagaatttggactgctcctgaaatttgcaggtctatgggccttgaaacttggcttgtatgactctacactggtagccaaaaaacatagatataccattgcaagtcagctagctctcattagatcatgccaatcaactaacaagcacgtcattcagtttttttcttctttttttttcctgtgggggctattgattcccgttctttgccaactgagggcttcctctgatttctgggtcgctctataggtattagctatcctacagatttgtttgcagcaattactgtcattgcaggaagagctcaattacaaaaccctaaggttcagtaacgacagcacgatgctgctatgacaggatgcagaagatgcattgttttcatcgatgttgattttcttgtaagatggaatgttgtaccaaacctgaacagatcactttgttgtgattcagtgtgcggctatggcctatggatttgtacttgttggactcacagagcatcgcgctttacatgcaaacggattttcg
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]