GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2024-07-23 23:35:50, GGRNA.v2 : RefSeq release 224 (May, 2024)

LOCUS       NM_001105218            2451 bp    mRNA    linear   VRT 26-JUN-2020
DEFINITION  Takifugu rubripes taste receptor, type 1, member 2b (tas1r2b),
            mRNA.
ACCESSION   NM_001105218
VERSION     NM_001105218.1
KEYWORDS    RefSeq.
SOURCE      Takifugu rubripes (Fugu rubripes)
  ORGANISM  Takifugu rubripes
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Actinopterygii; Neopterygii; Teleostei; Neoteleostei;
            Acanthomorphata; Eupercaria; Tetraodontiformes; Tetradontoidea;
            Tetraodontidae; Takifugu.
REFERENCE   1  (bases 1 to 2451)
  AUTHORS   Ishimaru Y, Okada S, Naito H, Nagai T, Yasuoka A, Matsumoto I and
            Abe K.
  TITLE     Two families of candidate taste receptors in fishes
  JOURNAL   Mech. Dev. 122 (12), 1310-1321 (2005)
   PUBMED   16274966
COMMENT     PROVISIONAL REFSEQ: This record has not yet been subject to final
            NCBI review. The reference sequence was derived from AB200912.1.
            
            ##Evidence-Data-START##
            Transcript exon combination :: AB200912.1 [ECO:0000332]
            RNAseq introns              :: mixed/partial sample support
                                           SAMN07340848, SAMN07340849
                                           [ECO:0000350]
            ##Evidence-Data-END##
FEATURES             Location/Qualifiers
     source          1..2451
                     /organism="Takifugu rubripes"
                     /mol_type="mRNA"
                     /db_xref="taxon:31033"
                     /chromosome="3"
                     /map="3"
     gene            1..2451
                     /gene="tas1r2b"
                     /note="taste receptor, type 1, member 2b"
                     /db_xref="GeneID:100125678"
     CDS             1..2451
                     /gene="tas1r2b"
                     /codon_start=1
                     /product="taste receptor, type 1, member 2b precursor"
                     /protein_id="NP_001098688.1"
                     /db_xref="GeneID:100125678"
                     /translation="
MGCSLACLCLLGCVLYPLAQCTVPASEFRLEGDYLIGGLFEIHYEAFPTFHGRPQTMDCSSKFLILSNYRRFQLMRFAVAEINNSTSLLPNVTLGYEVFDHCTDAQSFSDVFKLLSVNNVIQPWNVPNKNVSKVVAVLGLFSSTSTLTVAPLFMSDFIPLISYGSSSSIFSEKAKFPSFLRTVHSSKKVMEVIVKILQYFKWHWVAFLYSSDDYGTDGLKLFIEKIKDTEICLAYTHSLDSSHYLSVFNQIDAQRINLIVVFAPHWHAIPLVQAAIRHNVTGKVWIAGEAWSLNKELPKEKGIKNIGTVIGVSQPVVTIPGFEDFLYSVKKGNRCESTEQQFCNQIYNCSQESADILAADPSYSFSVYSAVYSTAHALHNVLNCDFGKCDNGIPISPPVLLAQLKKSNFTLLTERVQFDENGDPRFGSYAVLFWNQTGDPENFGTCCFYPSVKIFINDSKIQWHSKEVPISQCSKDCKEGYAKRIEGIHQCCFKCEICPNGTFVNRTKDPFNCIDCEEHQWSAAGSTSCLPRTVEYVAFTDTAAVVILVGAGLLLALTLAMCVLFAINYNTPVVRSAGGPMCFLILGCLSLCSISIFFFFDKPTVAFCVLRFLPFVLFYTVCLACFVVRSFQIVSIFKIAAKFPQAHSWWMKYHGQWLVISVTFVIQAFLIIVSVSSDPPSPFRDIVSYPDKIILGCFMNLKTSSVSFVLLLLLCLLCFIFSYMGKDLPKNYNEAKAITFCLLLLILTWIIFTTASLLYQGKYIHSLNALAVLSSIYSFLLWYFLPKCYIIIFQPQKNTQKYFQGLIQDYTKTISQ"
     sig_peptide     1..63
                     /gene="tas1r2b"
                     /inference="COORDINATES: ab initio prediction:SignalP:4.0"
     misc_feature    82..1413
                     /gene="tas1r2b"
                     /note="Type 1 periplasmic binding fold superfamily;
                     Region: Periplasmic_Binding_Protein_type1; cl10011"
                     /db_xref="CDD:471960"
     misc_feature    1405..1566
                     /gene="tas1r2b"
                     /note="Nine Cysteines Domain of family 3 GPCR; Region:
                     NCD3G; pfam07562"
                     /db_xref="CDD:462210"
     misc_feature    1624..2379
                     /gene="tas1r2b"
                     /note="seven-transmembrane G protein-coupled receptor
                     superfamily; Region: 7tm_GPCRs; cl28897"
                     /db_xref="CDD:475119"
     misc_feature    1627..1701
                     /gene="tas1r2b"
                     /note="TM helix 1 [structural motif]; Region: TM helix 1"
                     /db_xref="CDD:410628"
     misc_feature    1735..1800
                     /gene="tas1r2b"
                     /note="TM helix 2 [structural motif]; Region: TM helix 2"
                     /db_xref="CDD:410628"
     misc_feature    1825..1893
                     /gene="tas1r2b"
                     /note="TM helix 3 [structural motif]; Region: TM helix 3"
                     /db_xref="CDD:410628"
     misc_feature    1972..2022
                     /gene="tas1r2b"
                     /note="TM helix 4 [structural motif]; Region: TM helix 4"
                     /db_xref="CDD:410628"
     misc_feature    2098..2169
                     /gene="tas1r2b"
                     /note="TM helix 5 [structural motif]; Region: TM helix 5"
                     /db_xref="CDD:410628"
     misc_feature    2203..2271
                     /gene="tas1r2b"
                     /note="TM helix 6 [structural motif]; Region: TM helix 6"
                     /db_xref="CDD:410628"
     misc_feature    2284..2361
                     /gene="tas1r2b"
                     /note="TM helix 7 [structural motif]; Region: TM helix 7"
                     /db_xref="CDD:410628"
     exon            1..182
                     /gene="tas1r2b"
                     /inference="alignment:Splign:2.1.0"
     exon            183..480
                     /gene="tas1r2b"
                     /inference="alignment:Splign:2.1.0"
     exon            481..1197
                     /gene="tas1r2b"
                     /inference="alignment:Splign:2.1.0"
     exon            1198..1401
                     /gene="tas1r2b"
                     /inference="alignment:Splign:2.1.0"
     exon            1402..1522
                     /gene="tas1r2b"
                     /inference="alignment:Splign:2.1.0"
     exon            1523..2451
                     /gene="tas1r2b"
                     /inference="alignment:Splign:2.1.0"
ORIGIN      
atgggatgttctctggcttgcctgtgtctcctgggatgtgttctgtatccactggctcagtgcactgtcccagcctcagagtttaggctggaaggagattatttgattggtggcctttttgaaatccattacgaagccttcccaacctttcatggcagaccacaaaccatggactgctccagtaaattcctcattttgtcaaactatcgaaggtttcagttgatgagattcgccgtggcggaaatcaacaactccacgagcctcctgccaaatgtaactctcggttatgaggtgtttgaccactgcacggatgctcagagcttttcggacgttttcaaattactctcggtcaataatgtgatccaaccttggaacgtaccaaacaagaatgtgtccaaagtggtagcagtgctcggtctcttcagcagcacctctacgctgactgtggccccactgttcatgtctgatttcatcccactgatctcctatggatcctcaagttccatcttctcggaaaaggccaaatttccctctttcctgcgaacagtgcactccagcaaaaaagtgatggaagtgattgtaaaaattttgcagtacttcaagtggcactgggttgcctttctttacagcagtgatgattatggcaccgatgggcttaaactcttcatagagaagataaaggacactgagatctgcctggcgtacactcacagtcttgacagcagtcattacttatcagtatttaaccagatcgatgcccagaggattaaccttatcgtggtttttgctccccattggcacgctatacctctggttcaagcagcaatacggcacaatgtcacgggcaaggtgtggatagcaggagaagcatggtctctaaacaaggagctcccgaaggagaaaggaatcaaaaacatcggaaccgtgatcggggtgtcccagcccgtggtgacgattcctggttttgaagattttctttattcggttaaaaaggggaatcgatgtgaaagcaccgagcagcagttctgcaaccagatttacaactgcagtcaagagagcgctgatatcctagctgcggacccttcttactcgttttccgtttattctgctgtctacagcactgctcacgccttgcacaacgtcttaaactgtgactttggtaaatgtgataacggcattcccatatcgccacccgtgcttctagcccagttaaagaagtcaaattttacactcttaaccgagagagttcagttcgatgagaatggtgatcccaggtttggctcctatgcggtgttgttctggaaccagaccggtgacccagagaatttcggcacctgttgtttttacccttcggtcaaaatattcatcaatgacagcaaaatccagtggcactcaaaagaagtgcctatttcccagtgttccaaggactgtaaagaggggtatgcaaaaagaatagagggaatccatcaatgttgtttcaaatgtgaaatctgtccaaatggaacttttgtcaacagaacaaaggatcccttcaactgcatcgactgtgaggagcaccagtggtctgcagcaggaagcacatcgtgtctcccgcggacggtggagtacgtggcctttacggacacagcggcggtcgtgatcctggtcggagccggcctgttgctggctctcacgttagccatgtgtgttctctttgctatcaactacaacacgcctgtggtccgatctgccgggggacccatgtgctttctgatcttgggctgcctcagtctctgtagcatcagcatcttcttcttctttgacaaaccgactgttgccttttgcgttttaagattcctgccctttgttttattctacactgtctgtctcgcctgctttgtcgtccgctcctttcagatcgtcagcatttttaaaatagctgccaagttcccccaagcccacagctggtggatgaagtatcacggtcagtggctggtcatctccgtcacctttgtcattcaggcatttctgatcattgtcagcgtatcatctgaccccccctcacccttcagggacattgtctcttacccagacaaaatcatccttggatgtttcatgaatcttaaaacatcatctgtttcatttgttttacttctattgttgtgcctgctctgcttcattttttcctacatgggcaaagaccttccgaaaaattacaacgaggccaaagcgataaccttctgcctgctcctgctgatcctcacctggatcatatttaccaccgcgtccctgctttaccaaggcaaatacattcactcactgaacgctttggcagtgctctccagcatctactcctttttgttgtggtatttcctcccaaaatgttacatcatcatttttcagcctcagaagaacacacagaagtacttccaaggtctgattcaggattacaccaagactattagccagtag
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]