2025-07-19 08:43:27, GGRNA.v2 : RefSeq release 229 (Mar, 2025)
LOCUS NM_001078602 921 bp mRNA linear VRT 27-JUN-2020 DEFINITION Takifugu rubripes taste receptor, type 2, member 1 (tas2r1), mRNA. ACCESSION NM_001078602 VERSION NM_001078602.1 KEYWORDS RefSeq. SOURCE Takifugu rubripes (Fugu rubripes) ORGANISM Takifugu rubripes Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Actinopterygii; Neopterygii; Teleostei; Neoteleostei; Acanthomorphata; Eupercaria; Tetraodontiformes; Tetradontoidea; Tetraodontidae; Takifugu. REFERENCE 1 (bases 1 to 921) AUTHORS Go Y. CONSRTM SMBE Tri-National Young Investigators TITLE Proceedings of the SMBE Tri-National Young Investigators' Workshop 2005. Lineage-specific expansions and contractions of the bitter taste receptor gene repertoire in vertebrates JOURNAL Mol. Biol. Evol. 23 (5), 964-972 (2006) PUBMED 16484289 REFERENCE 2 (bases 1 to 921) AUTHORS Ishimaru Y, Okada S, Naito H, Nagai T, Yasuoka A, Matsumoto I and Abe K. TITLE Two families of candidate taste receptors in fishes JOURNAL Mech. Dev. 122 (12), 1310-1321 (2005) PUBMED 16274966 COMMENT PROVISIONAL REFSEQ: This record has not yet been subject to final NCBI review. The reference sequence was derived from AB200914.1. ##Evidence-Data-START## Transcript exon combination :: AB200914.1 [ECO:0000332] ##Evidence-Data-END## FEATURES Location/Qualifiers source 1..921 /organism="Takifugu rubripes" /mol_type="mRNA" /db_xref="taxon:31033" /chromosome="21" /map="21" gene 1..921 /gene="tas2r1" /note="taste receptor, type 2, member 1" /db_xref="GeneID:777978" CDS 1..921 /gene="tas2r1" /note="bitter taste receptor" /codon_start=1 /product="taste receptor, type 2, member 1" /protein_id="NP_001072070.1" /db_xref="GeneID:777978" /translation="
MLESDDLKLCGIALFLVLGVLANLFNLGAMLGQQQGRTVAVIICFISLGNILLQTSTCVLVASIRAGVLCRPHLPFFFSGVLYVWFISSSVSIWSVAWLNVFYCVKVCRFSWIICRTLEENISSILNITMVIMFLTSCVMFTPFFGLHFQDQHVNATEMGACVIRKPLLPAWVDINTYVITFICFLTLMPSTIMLPTSLGLVVYLCRRTAKTQRSSSAESYLLVCRLTVALVWVYLTTLLIISLYYFHALFASGLSADVLFSGLSFYCVACAALLSCSNKHLRGKLRALLCRGKRTNTMVINAEGE"
exon 1..921 /gene="tas2r1" /inference="alignment:Splign:2.1.0" ORIGIN
atgcttgaatcagatgatttgaagctgtgtggcatcgctctgttccttgtcctgggagtcctcgccaaccttttcaacctgggtgcaatgctggggcagcagcaggggagaactgtggctgtcattatttgcttcatctcgctgggcaatatcctgctccagacctccacgtgtgtccttgtggcttccatcagggctggggtgctctgccgccctcacttacccttcttcttcagcggggttctgtatgtttggttcatcagcagctccgtcagcatctggtctgttgcctggctgaatgtcttctactgtgtgaaggtctgtaggttctcctggattatctgcagaaccctcgaggagaacatctctagcatcctgaacattaccatggtgataatgttcctgacctcctgcgtgatgttcacccctttcttcggcctccacttccaagaccaacacgtgaatgcgacagaaatgggtgcttgtgtcatcaggaaacctctgctgccagcctgggttgacatcaacacctatgtgatcacttttatctgcttcctcacgctgatgccctccaccatcatgctgcccacctcactaggcctggtggtctacctctgcagacgtacggcgaagacgcagaggagcagctcagcagagtcctacctgctggtctgcaggctgacagtcgctctggtttgggtttacctcaccactctgctcatcatctcgctctactacttccatgctctcttcgcttcagggctgagtgcagacgtgctcttctcgggcttgtccttttattgtgtggcttgtgcagcgctcctcagctgctccaacaaacacttgagagggaagttgagagcgttgctctgcagaggaaagaggacaaatacaatggtcattaatgcagaaggggagtag
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]