GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2024-07-24 00:36:41, GGRNA.v2 : RefSeq release 224 (May, 2024)

LOCUS       NM_001078602             921 bp    mRNA    linear   VRT 27-JUN-2020
DEFINITION  Takifugu rubripes taste receptor, type 2, member 1 (tas2r1), mRNA.
ACCESSION   NM_001078602
VERSION     NM_001078602.1
KEYWORDS    RefSeq.
SOURCE      Takifugu rubripes (Fugu rubripes)
  ORGANISM  Takifugu rubripes
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Actinopterygii; Neopterygii; Teleostei; Neoteleostei;
            Acanthomorphata; Eupercaria; Tetraodontiformes; Tetradontoidea;
            Tetraodontidae; Takifugu.
REFERENCE   1  (bases 1 to 921)
  AUTHORS   Go Y.
  CONSRTM   SMBE Tri-National Young Investigators
  TITLE     Proceedings of the SMBE Tri-National Young Investigators' Workshop
            2005. Lineage-specific expansions and contractions of the bitter
            taste receptor gene repertoire in vertebrates
  JOURNAL   Mol. Biol. Evol. 23 (5), 964-972 (2006)
   PUBMED   16484289
REFERENCE   2  (bases 1 to 921)
  AUTHORS   Ishimaru Y, Okada S, Naito H, Nagai T, Yasuoka A, Matsumoto I and
            Abe K.
  TITLE     Two families of candidate taste receptors in fishes
  JOURNAL   Mech. Dev. 122 (12), 1310-1321 (2005)
   PUBMED   16274966
COMMENT     PROVISIONAL REFSEQ: This record has not yet been subject to final
            NCBI review. The reference sequence was derived from AB200914.1.
            
            ##Evidence-Data-START##
            Transcript exon combination :: AB200914.1 [ECO:0000332]
            ##Evidence-Data-END##
FEATURES             Location/Qualifiers
     source          1..921
                     /organism="Takifugu rubripes"
                     /mol_type="mRNA"
                     /db_xref="taxon:31033"
                     /chromosome="21"
                     /map="21"
     gene            1..921
                     /gene="tas2r1"
                     /note="taste receptor, type 2, member 1"
                     /db_xref="GeneID:777978"
     CDS             1..921
                     /gene="tas2r1"
                     /note="bitter taste receptor"
                     /codon_start=1
                     /product="taste receptor, type 2, member 1"
                     /protein_id="NP_001072070.1"
                     /db_xref="GeneID:777978"
                     /translation="
MLESDDLKLCGIALFLVLGVLANLFNLGAMLGQQQGRTVAVIICFISLGNILLQTSTCVLVASIRAGVLCRPHLPFFFSGVLYVWFISSSVSIWSVAWLNVFYCVKVCRFSWIICRTLEENISSILNITMVIMFLTSCVMFTPFFGLHFQDQHVNATEMGACVIRKPLLPAWVDINTYVITFICFLTLMPSTIMLPTSLGLVVYLCRRTAKTQRSSSAESYLLVCRLTVALVWVYLTTLLIISLYYFHALFASGLSADVLFSGLSFYCVACAALLSCSNKHLRGKLRALLCRGKRTNTMVINAEGE"
     exon            1..921
                     /gene="tas2r1"
                     /inference="alignment:Splign:2.1.0"
ORIGIN      
atgcttgaatcagatgatttgaagctgtgtggcatcgctctgttccttgtcctgggagtcctcgccaaccttttcaacctgggtgcaatgctggggcagcagcaggggagaactgtggctgtcattatttgcttcatctcgctgggcaatatcctgctccagacctccacgtgtgtccttgtggcttccatcagggctggggtgctctgccgccctcacttacccttcttcttcagcggggttctgtatgtttggttcatcagcagctccgtcagcatctggtctgttgcctggctgaatgtcttctactgtgtgaaggtctgtaggttctcctggattatctgcagaaccctcgaggagaacatctctagcatcctgaacattaccatggtgataatgttcctgacctcctgcgtgatgttcacccctttcttcggcctccacttccaagaccaacacgtgaatgcgacagaaatgggtgcttgtgtcatcaggaaacctctgctgccagcctgggttgacatcaacacctatgtgatcacttttatctgcttcctcacgctgatgccctccaccatcatgctgcccacctcactaggcctggtggtctacctctgcagacgtacggcgaagacgcagaggagcagctcagcagagtcctacctgctggtctgcaggctgacagtcgctctggtttgggtttacctcaccactctgctcatcatctcgctctactacttccatgctctcttcgcttcagggctgagtgcagacgtgctcttctcgggcttgtccttttattgtgtggcttgtgcagcgctcctcagctgctccaacaaacacttgagagggaagttgagagcgttgctctgcagaggaaagaggacaaatacaatggtcattaatgcagaaggggagtag
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]