GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2019-03-25 08:18:43, GGRNA.v2 : RefSeq release 92 (Jan, 2019)

LOCUS       NM_001025654             900 bp    mRNA    linear   ROD 19-JUL-2017
DEFINITION  Rattus norvegicus Rhox homeobox family member 7 (Rhox7), mRNA.
ACCESSION   NM_001025654 XM_233326
VERSION     NM_001025654.1
KEYWORDS    RefSeq.
SOURCE      Rattus norvegicus (Norway rat)
  ORGANISM  Rattus norvegicus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha;
            Muroidea; Muridae; Murinae; Rattus.
COMMENT     PROVISIONAL REFSEQ: This record has not yet been subject to final
            NCBI review. The reference sequence was derived from DQ058654.1.
            On Jul 22, 2005 this sequence version replaced XM_233326.3.
            
            ##Evidence-Data-START##
            Transcript exon combination :: DQ058654.1 [ECO:0000332]
            ##Evidence-Data-END##
FEATURES             Location/Qualifiers
     source          1..900
                     /organism="Rattus norvegicus"
                     /mol_type="mRNA"
                     /strain="Sprague-Dawley"
                     /db_xref="taxon:10116"
                     /chromosome="X"
                     /map="Xq11"
     gene            1..900
                     /gene="Rhox7"
                     /note="Rhox homeobox family member 7"
                     /db_xref="GeneID:298353"
                     /db_xref="RGD:1563189"
     CDS             1..768
                     /gene="Rhox7"
                     /note="reproductive homeobox on X chromosome 7;
                     reproductive homeobox 7"
                     /codon_start=1
                     /product="Rhox homeobox family member 7"
                     /protein_id="NP_001020825.1"
                     /db_xref="GeneID:298353"
                     /db_xref="RGD:1563189"
                     /translation="
MWFSNRRAKERACEKKAMPRSIPGAKAQMILPAGEGRNGEESERSSPGQEASATKWGEVEELGERDRTGSDGENLSAVGTSGIRNDWDKEGASSSRQKNESRPQKPVPECRWGMEDVQPVPVLIPRVQRIQLVQSRVQSVPLKVPTPRIRPVAVSATTVQPEPVLVPRRHLHDRFTDPELQELERERVFQRNHYLSAEERKELARVMGVSEAKVQRWFKKRREHFRREQSQSGGAPPGNTPPLSEDGAGALVYHP"
     misc_feature    order(520..522,646..648,655..660,667..669)
                     /gene="Rhox7"
                     /note="specific DNA base contacts [nucleotide binding];
                     other site"
                     /db_xref="CDD:238039"
     misc_feature    520..666
                     /gene="Rhox7"
                     /note="Homeobox domain; Region: Homeobox; pfam00046"
                     /db_xref="CDD:278475"
ORIGIN      
atgtggtttagcaataggagagccaaagagagggcctgtgagaagaaagcaatgcccaggagcataccaggtgcgaaagcacagatgatcttgcccgctggagagggaagaaatggggaagagagtgaacggtcgtcccctgggcaggaggcttcagcaacaaaatggggagaagtagaagaactgggagaaagggacagaacggggagtgatggagaaaatctttctgctgtaggaacttcaggcatcaggaatgactgggacaaagagggtgccagcagcagtaggcagaagaatgagagtcggcctcagaagccagtccctgagtgtaggtggggcatggaggatgtacagccagtgccagtactgattccccgtgtacaacggatacaacttgtgcaatcccgggtacagtcggtgcccctaaaggtacctacacctcgcataaggccggtggcagtttcggcgaccactgtacagcctgagccagtgctggtgcctcgccgccatctccatgacagatttacagacccagagctgcaggagctggaacgcgaacgcgttttccagaggaatcactatctcagtgctgaagaaagaaaagagctggcaagggtgatgggcgtgagtgaggccaaagtgcagagatggtttaagaagaggagagaacacttcaggagagaacaaagtcagtcaggtggtgctcctcctgggaatactccacctctctctgaagatggcgcaggagccctagtgtaccacccttgacctagagccactggcagacgcctgctttcttccaccaacatgttattgcctctttatcccctaagcacttgtatttgaaataaatagattctctgtttatttgcttcctgtgtcttctggattagtacggca
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]