GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2019-03-22 05:03:44, GGRNA.v2 : RefSeq release 92 (Jan, 2019)

LOCUS       NM_001025355            1453 bp    mRNA    linear   VRT 16-SEP-2018
DEFINITION  Gallus gallus homeobox B5 (HOXB5), mRNA.
ACCESSION   NM_001025355 XM_422888
VERSION     NM_001025355.1
KEYWORDS    RefSeq.
SOURCE      Gallus gallus (chicken)
  ORGANISM  Gallus gallus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Archelosauria; Archosauria; Dinosauria; Saurischia; Theropoda;
            Coelurosauria; Aves; Neognathae; Galloanserae; Galliformes;
            Phasianidae; Phasianinae; Gallus.
REFERENCE   1  (bases 1 to 1453)
  AUTHORS   Wedden SE, Pang K and Eichele G.
  TITLE     Expression pattern of homeobox-containing genes during chick
            embryogenesis
  JOURNAL   Development 105 (3), 639-650 (1989)
   PUBMED   2575515
COMMENT     PROVISIONAL REFSEQ: This record has not yet been subject to final
            NCBI review. The reference sequence was derived from AY875647.1.
            On Jul 14, 2005 this sequence version replaced XM_422888.1.
            
            ##Evidence-Data-START##
            Transcript exon combination :: AY875647.1, AB193110.1 [ECO:0000332]
            ##Evidence-Data-END##
FEATURES             Location/Qualifiers
     source          1..1453
                     /organism="Gallus gallus"
                     /mol_type="mRNA"
                     /db_xref="taxon:9031"
                     /chromosome="27"
                     /map="27"
     gene            1..1453
                     /gene="HOXB5"
                     /gene_synonym="Ghox-2.1; Hoxb-5"
                     /note="homeobox B5"
                     /db_xref="CGNC:52343"
                     /db_xref="GeneID:425096"
     exon            1..607
                     /gene="HOXB5"
                     /gene_synonym="Ghox-2.1; Hoxb-5"
                     /inference="alignment:Splign:2.1.0"
     CDS             61..855
                     /gene="HOXB5"
                     /gene_synonym="Ghox-2.1; Hoxb-5"
                     /note="homeo box B5; homeobox protein Hox-2.1"
                     /codon_start=1
                     /product="homeobox protein Hox-B5"
                     /protein_id="NP_001020526.1"
                     /db_xref="CGNC:52343"
                     /db_xref="GeneID:425096"
                     /translation="
MSSYFVNSFSGRYPNGPDYQLLNYGTSSSMNGSYRDSSTMHSSSYGYNYNGMDLSINRSASSSHFGAVGESSRGFPSPAQESRFRQASSCSLSSPDSLPCSNSESHGGKPAPSPSDQATSASTNTNFTELDETSASSGADEGTPISSSIPRAQAEPIATSTAATEGQAPQIFPWMRKLHISHDMTGPDGKRARTAYTRYQTLELEKEFHFNRYLTRRRRIEIAHALCLSERQIKIWFQNRRMKWKKDNKLKSMSLASAGSAFQP"
     misc_feature    625..804
                     /gene="HOXB5"
                     /gene_synonym="Ghox-2.1; Hoxb-5"
                     /note="Region: homeobox"
     misc_feature    order(628..642,646..648,697..699,715..717,754..756,
                     760..765,772..777,781..789,793..798)
                     /gene="HOXB5"
                     /gene_synonym="Ghox-2.1; Hoxb-5"
                     /note="DNA binding site [nucleotide binding]"
                     /db_xref="CDD:238039"
     misc_feature    order(634..636,643..645,763..765,772..777,784..786)
                     /gene="HOXB5"
                     /gene_synonym="Ghox-2.1; Hoxb-5"
                     /note="specific DNA base contacts [nucleotide binding];
                     other site"
                     /db_xref="CDD:238039"
     misc_feature    637..795
                     /gene="HOXB5"
                     /gene_synonym="Ghox-2.1; Hoxb-5"
                     /note="Homeobox domain; Region: Homeobox; pfam00046"
                     /db_xref="CDD:306543"
     exon            608..1453
                     /gene="HOXB5"
                     /gene_synonym="Ghox-2.1; Hoxb-5"
                     /inference="alignment:Splign:2.1.0"
ORIGIN      
cgtcaagcacagggttataacgaccacgagccacaaatcaagccctccaaaataacccaaatgagctcttactttgtaaactcgttctcagggcgctacccaaatggccccgactatcagttactaaattatgggaccagcagttccatgaacggttcttacagagattcaagcaccatgcattccagctcttatggctacaactacaatgggatggaccttagcatcaaccgctcagcctcctctagtcactttggggctgtgggggagagctcccgcggtttcccttctccagctcaggagagcaggtttagacaggcgtctagctgctccttatcttctcccgactcccttccctgctccaacagcgagagccatggaggcaagcccgccccgtccccctccgaccaagctacttctgccagcaccaacacaaatttcacagaactagacgagaccagcgcgtcctcgggagccgacgagggcactccaataagcagcagcatcccccgagcgcaggcagagcccatcgcaacctccacggcagcaacagaagggcaggcacctcagatattcccttggatgaggaaacttcacattagtcatgacatgactggaccagacgggaagagggcgaggacagcgtacactcgctaccagaccctggagttggaaaaggaattccacttcaatagatatctcacccgcaggaggagaatagagatcgctcacgctctgtgcctctccgagaggcagatcaaaatctggttccagaacaggaggatgaaatggaagaaggataataaactgaaaagcatgagcttagcttctgcgggcagcgcctttcagccataaattatagaggaaggaatatcgaggaaagaagaggaaacattaaataaatccgtaaataaataaagcgcagcagatcttagttttggagtactgtacagtgaggcaccttcttttcggcatgttgttgctattcgaaaccgacgcgtatggtacctttatcccaggactgagttcatgtcgtggttttttcttttttgggttgatttattaatttttttcctattatttttttttaattattattaaattttatttccagatgctccccatgctctcgttgtttttataaatgtacgtgtccgtgctatcttgatgctttctggaaagccagcatgttttatgtgagccctataaatgttataacttatttatgagatggtaacagataacgattgtttgtttatttgttgctttttccccttcctgagtttactgctttgggggtgagtttttctctgcctgagctaaaatcgggggttcctgcactacagtcgcagtaaaaaataataataagcaagaaaaaaaaacataaaaaagagggggaaaaaagagaaaaaaaagggggaaaaagattaaaaaaatttaaaaaggggaaaaa
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]