LOCUS       NM_001025086             983 bp    mRNA    linear   ROD 04-AUG-2023
DEFINITION  Mus musculus reproductive homeobox 7A (Rhox7a), mRNA.
ACCESSION   NM_001025086 XM_622029
VERSION     NM_001025086.2
KEYWORDS    RefSeq; RefSeq Select.
SOURCE      Mus musculus (house mouse)
  ORGANISM  Mus musculus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha;
            Muroidea; Muridae; Murinae; Mus; Mus.
REFERENCE   1  (bases 1 to 983)
  AUTHORS   Wilming LG, Boychenko V and Harrow JL.
  TITLE     Comprehensive comparative homeobox gene annotation in human and
            mouse
  JOURNAL   Database (Oxford) 2015 (2015)
   PUBMED   26412852
  REMARK    Publication Status: Online-Only
REFERENCE   2  (bases 1 to 983)
  AUTHORS   Daggag H, Svingen T, Western PS, van den Bergen JA, McClive PJ,
            Harley VR, Koopman P and Sinclair AH.
  TITLE     The rhox homeobox gene family shows sexually dimorphic and dynamic
            expression during mouse embryonic gonad development
  JOURNAL   Biol Reprod 79 (3), 468-474 (2008)
   PUBMED   18562707
REFERENCE   3  (bases 1 to 983)
  AUTHORS   Maclean JA 2nd, Chen MA, Wayne CM, Bruce SR, Rao M, Meistrich ML,
            Macleod C and Wilkinson MF.
  TITLE     Rhox: a new homeobox gene cluster
  JOURNAL   Cell 120 (3), 369-382 (2005)
   PUBMED   15707895
COMMENT     VALIDATED REFSEQ: This record has undergone validation or
            preliminary review. The reference sequence was derived from
            AL590629.16.
            
            On Sep 7, 2007 this sequence version replaced NM_001025086.1.
            
            Sequence Note: The RefSeq transcript and protein were derived from
            genomic sequence to make the sequence consistent with the reference
            genome assembly. The genomic coordinates used for the transcript
            record were based on alignments.
            
            ##Evidence-Data-START##
            Transcript exon combination :: DQ058644.1 [ECO:0000332]
            ##Evidence-Data-END##
            
            ##RefSeq-Attributes-START##
            RefSeq Select criteria :: based on single protein-coding transcript
            ##RefSeq-Attributes-END##
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-80                AL590629.16        17022-17101
            81-184              AL590629.16        18344-18447
            185-230             AL590629.16        19568-19613
            231-300             AL590629.16        21013-21082
            301-668             AL590629.16        23488-23855
            669-820             AL590629.16        24553-24704
            821-866             AL590629.16        25328-25373
            867-983             AL590629.16        26391-26507
FEATURES             Location/Qualifiers
     source          1..983
                     /organism="Mus musculus"
                     /mol_type="mRNA"
                     /db_xref="taxon:10090"
                     /chromosome="X"
                     /map="X 22.08 cM"
     gene            1..983
                     /gene="Rhox7a"
                     /gene_synonym="Gm712; Rhox7"
                     /note="reproductive homeobox 7A"
                     /db_xref="GeneID:547168"
                     /db_xref="MGI:MGI:3580246"
     exon            1..80
                     /gene="Rhox7a"
                     /gene_synonym="Gm712; Rhox7"
                     /inference="alignment:Splign:2.1.0"
     exon            81..184
                     /gene="Rhox7a"
                     /gene_synonym="Gm712; Rhox7"
                     /inference="alignment:Splign:2.1.0"
     CDS             138..983
                     /gene="Rhox7a"
                     /gene_synonym="Gm712; Rhox7"
                     /note="reproductive homeobox on X chromosome 7;
                     reproductive homeobox on chromosome X, 7"
                     /codon_start=1
                     /product="reproductive homeobox 7"
                     /protein_id="NP_001020257.2"
                     /db_xref="CCDS:CCDS30081.1"
                     /db_xref="GeneID:547168"
                     /db_xref="MGI:MGI:3580246"
                     /translation="

METMFQETQYPDVLTREVLARSMDGSEAKVQIRFNNRRAKQRAREKKAMLRSTAGAKAPLVLPAGEERNGEDSRDQSSPGLGASAAEWGGVEGPGELGRKEKNGASPSAVDTSGVRGDWTQKGASGSSQKNERRPQNRVPECRWGTEDVHPVPVLVPRAQRRQRVGSRSRGQSVSLKCPRIRPVLVSTVQPVPVLVPHRPLRDGFTEPQLQELEQVFQRNHYLRAEEGKQLARGTGVTEAKLQRWFKKRRVQFRREHSQSRMNDDAPPRTHSTSLKMAQEP"

     misc_feature    <138..263
                     /gene="Rhox7a"
                     /gene_synonym="Gm712; Rhox7"
                     /note="Homeodomain; DNA binding domains involved in the
                     transcriptional regulation of key eukaryotic developmental
                     processes; may bind to DNA as monomers or as homo- and/or
                     heterodimers, in a sequence-specific manner; Region:
                     homeodomain; cl00084"
                     /db_xref="CDD:444687"
     misc_feature    741..908
                     /gene="Rhox7a"
                     /gene_synonym="Gm712; Rhox7"
                     /note="Homeodomain; DNA binding domains involved in the
                     transcriptional regulation of key eukaryotic developmental
                     processes; may bind to DNA as monomers or as homo- and/or
                     heterodimers, in a sequence-specific manner; Region:
                     homeodomain; cd00086"
                     /db_xref="CDD:238039"
     misc_feature    order(741..746,750..752,801..803,819..821,858..860,
                     864..869,876..881,885..893,897..902)
                     /gene="Rhox7a"
                     /gene_synonym="Gm712; Rhox7"
                     /note="DNA binding site [nucleotide binding]"
                     /db_xref="CDD:238039"
     misc_feature    order(747..749,867..869,876..881,888..890)
                     /gene="Rhox7a"
                     /gene_synonym="Gm712; Rhox7"
                     /note="specific DNA base contacts [nucleotide binding];
                     other site"
                     /db_xref="CDD:238039"
     exon            185..230
                     /gene="Rhox7a"
                     /gene_synonym="Gm712; Rhox7"
                     /inference="alignment:Splign:2.1.0"
     exon            231..300
                     /gene="Rhox7a"
                     /gene_synonym="Gm712; Rhox7"
                     /inference="alignment:Splign:2.1.0"
     exon            301..668
                     /gene="Rhox7a"
                     /gene_synonym="Gm712; Rhox7"
                     /inference="alignment:Splign:2.1.0"
     exon            669..820
                     /gene="Rhox7a"
                     /gene_synonym="Gm712; Rhox7"
                     /inference="alignment:Splign:2.1.0"
     exon            821..866
                     /gene="Rhox7a"
                     /gene_synonym="Gm712; Rhox7"
                     /inference="alignment:Splign:2.1.0"
     exon            867..983
                     /gene="Rhox7a"
                     /gene_synonym="Gm712; Rhox7"
                     /inference="alignment:Splign:2.1.0"
ORIGIN      

ataatcaccgagttctcacggagggggtcaaccgtggcaactcggagagaaagagcgatgggttcactagggatccccagcgccagggcaggaggcaccagatccagttcaccttcacaccctggcaagtgcaggagatggagaccatgttccaagagactcagtacccagatgtgcttacaagagaggtgcttgccagaagcatggatgggtctgaagccaaggtgcagataaggtttaacaacaggagagccaaacagagggccagggagaagaaagcaatgctcaggagcacagcaggtgcaaaagcccccctggtcttgcctgctggtgaggaaagaaatggggaagattcacgtgaccagtcctcccctggactgggagcctctgcagcagaatggggcggagtagaaggaccaggggaactggggagaaaggagaagaatggagccagtccttctgctgtagacacctctggcgtcaggggtgactggacccaaaagggggccagcggcagtagccagaaaaatgagcgtcggcctcagaatcgggtccctgagtgtaggtggggcactgaggacgtgcaccctgtgccagtgctggtgcctcgtgcccagcggaggcagcgtgtgggatcccgatcccggggacagtctgtgtctctaaagtgcccccgcatacggccagttttggtgtccactgtacagcctgtgccagtgctggtgccccaccgccccctccgggacggatttacagagccacagctgcaggagctggaacaggttttccagagaaaccactatctccgtgctgaagaaggaaaacagctggcaaggggaacgggtgtgactgaggccaagttgcagagatggtttaagaagaggagagtgcagttcaggagagaacacagtcagtcaaggatgaatgatgatgccccacccaggacccactccacctctctgaagatggcgcaggagccctag

//