LOCUS       NM_001020505             963 bp    mRNA    linear   VRT 02-APR-2025
DEFINITION  Danio rerio taste receptor, type 2, member 200, tandem duplicate 2
            (tas2r200.2), mRNA.
ACCESSION   NM_001020505
VERSION     NM_001020505.1
KEYWORDS    RefSeq.
SOURCE      Danio rerio (zebrafish)
  ORGANISM  Danio rerio
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Actinopterygii; Neopterygii; Teleostei; Ostariophysi;
            Cypriniformes; Danionidae; Danioninae; Danio.
REFERENCE   1  (bases 1 to 963)
  AUTHORS   Kowatschew,D. and Korsching,S.I.
  TITLE     An Ancient Adenosine Receptor Gains Olfactory Function in Bony
            Vertebrates
  JOURNAL   Genome Biol Evol 13 (9) (2021)
   PUBMED   34499158
REFERENCE   2  (bases 1 to 963)
  AUTHORS   Behrens,M., Di Pizio,A., Redel,U., Meyerhof,W. and Korsching,S.I.
  TITLE     At the Root of T2R Gene Evolution: Recognition Profiles of
            Coelacanth and Zebrafish Bitter Receptors
  JOURNAL   Genome Biol Evol 13 (1) (2021)
   PUBMED   33355666
REFERENCE   3  (bases 1 to 963)
  AUTHORS   Oike,H., Nagai,T., Furuyama,A., Okada,S., Aihara,Y., Ishimaru,Y.,
            Marui,T., Matsumoto,I., Misaka,T. and Abe,K.
  TITLE     Characterization of ligands for fish taste receptors
  JOURNAL   J Neurosci 27 (21), 5584-5592 (2007)
   PUBMED   17522303
REFERENCE   4  (bases 1 to 963)
  AUTHORS   Go,Y.
  CONSRTM   SMBE Tri-National Young Investigators
  TITLE     Proceedings of the SMBE Tri-National Young Investigators' Workshop
            2005. Lineage-specific expansions and contractions of the bitter
            taste receptor gene repertoire in vertebrates
  JOURNAL   Mol Biol Evol 23 (5), 964-972 (2006)
   PUBMED   16484289
REFERENCE   5  (bases 1 to 963)
  AUTHORS   Ishimaru,Y., Okada,S., Naito,H., Nagai,T., Yasuoka,A., Matsumoto,I.
            and Abe,K.
  TITLE     Two families of candidate taste receptors in fishes
  JOURNAL   Mech Dev 122 (12), 1310-1321 (2005)
   PUBMED   16274966
REFERENCE   6  (bases 1 to 963)
  AUTHORS   Pfister,P. and Rodriguez,I.
  TITLE     Olfactory expression of a single and highly variable V1r pheromone
            receptor-like gene in fish species
  JOURNAL   Proc Natl Acad Sci U S A 102 (15), 5489-5494 (2005)
   PUBMED   15809442
COMMENT     PROVISIONAL REFSEQ: This record has not yet been subject to final
            NCBI review. The reference sequence was derived from AY764273.1.
            
            ##Evidence-Data-START##
            Transcript is intronless :: AB200904.1 [ECO:0000345]
            ##Evidence-Data-END##
FEATURES             Location/Qualifiers
     source          1..963
                     /organism="Danio rerio"
                     /mol_type="mRNA"
                     /db_xref="taxon:7955"
                     /chromosome="8"
                     /map="8"
     gene            1..963
                     /gene="tas2r200.2"
                     /gene_synonym="T2R2; TAS2R1b; tas2r2l"
                     /note="taste receptor, type 2, member 200, tandem
                     duplicate 2"
                     /db_xref="GeneID:553134"
                     /db_xref="ZFIN:ZDB-GENE-050510-4"
     CDS             1..963
                     /gene="tas2r200.2"
                     /gene_synonym="T2R2; TAS2R1b; tas2r2l"
                     /note="taste receptor, type 2, member 1b; bitter taste
                     receptor; taste receptor 2, member 2 like; zfT2R1b; taste
                     receptor, type 2, member 200.2"
                     /codon_start=1
                     /product="taste receptor, type 2, member 200, tandem
                     duplicate 2"
                     /protein_id="NP_001018341.1"
                     /db_xref="GeneID:553134"
                     /db_xref="ZFIN:ZDB-GENE-050510-4"
                     /translation="

MSTDVGDVLFFLGVGVVGVSGNIFNLIFTVQQQVKTRTIQTVGLILDVISISNIILALAILSMVVGIFLNPQIWCIKPYPFDLRLEIYLMLTCGFISFWAIAWLSLFYCIKVVNFSSEIFRTLKKNISTVINTAVLLSCLFSCLFFIPLFSLDTVDSTEQNDNAYGNVTCPMPSFTIQMNQDAYSAAVLFLLCPIPLMIMLPTSVRMVVHLCAHTRALQKNQTQVQGSDSYLLVCKLTISLVGVYLFNLFFVSLFILMKLIGAYITYQYLVSTFTFYCGVTSALLTASNRYLKDKLWSLFCCRKAKEPASKSHTVVTGDV"

     misc_feature    100..>669
                     /gene="tas2r200.2"
                     /gene_synonym="T2R2; TAS2R1b; tas2r2l"
                     /note="seven-transmembrane G protein-coupled receptor
                     superfamily; Region: 7tm_GPCRs; cl28897"
                     /db_xref="CDD:475119"
     misc_feature    127..192
                     /gene="tas2r200.2"
                     /gene_synonym="T2R2; TAS2R1b; tas2r2l"
                     /note="TM helix 2 [structural motif]; Region: TM helix 2"
                     /db_xref="CDD:410628"
     misc_feature    250..318
                     /gene="tas2r200.2"
                     /gene_synonym="T2R2; TAS2R1b; tas2r2l"
                     /note="TM helix 3 [structural motif]; Region: TM helix 3"
                     /db_xref="CDD:410628"
     misc_feature    397..447
                     /gene="tas2r200.2"
                     /gene_synonym="T2R2; TAS2R1b; tas2r2l"
                     /note="TM helix 4 [structural motif]; Region: TM helix 4"
                     /db_xref="CDD:410628"
     misc_feature    544..615
                     /gene="tas2r200.2"
                     /gene_synonym="T2R2; TAS2R1b; tas2r2l"
                     /note="TM helix 5 [structural motif]; Region: TM helix 5"
                     /db_xref="CDD:410628"
     exon            1..963
                     /gene="tas2r200.2"
                     /gene_synonym="T2R2; TAS2R1b; tas2r2l"
                     /inference="alignment:Splign:2.1.0"
ORIGIN      

atgagcaccgacgttggcgacgttctttttttccttggagttggggttgtcggtgtttctggaaatatattcaacctcattttcactgtacaacagcaagtaaaaaccagaaccattcagactgtgggcttgatcctagatgtcatctccatcagcaacatcatcttagcactggctattctcagcatggtggttggcatctttctaaatccccaaatctggtgcatcaagccatatccttttgatctccgtcttgaaatttatctaatgttgacttgcggcttcatcagcttctgggccattgcttggctgagtctcttctactgcatcaaagttgtaaatttctcctctgagattttcagaacactgaagaagaacatctcaactgtgatcaacactgcggtgctgctgagctgcttgttctcctgcttgtttttcatcccactgttcagccttgatactgtggattcaacggaacaaaatgacaatgcgtatggtaatgtgacctgtccaatgccttctttcactattcagatgaaccaagatgcatactcagctgctgttctgttcctcctctgcccaattccactgatgatcatgttgcccacctctgtcagaatggtggtccatctatgcgcccacacacgggcactccaaaagaaccagacgcaggtgcagggatccgactcatatctccttgtgtgcaaactcaccatctccctggtgggagtttatctgttcaacctattctttgtgtctttgttcatccttatgaagctaatcggggcatatatcacatatcaatacctagtcagtacttttaccttttactgtggagtgacttcagcactcctgacggcttcaaacaggtatctgaaagataagctctggagtttgttctgttgcagaaaagcaaaggagccagctagcaaaagccacacagttgtgacaggggatgtttga

//