GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2019-03-25 14:33:12, GGRNA.v2 : RefSeq release 92 (Jan, 2019)

LOCUS       NM_001007985             927 bp    mRNA    linear   VRT 11-NOV-2018
DEFINITION  Gallus gallus H6 family homeobox 3 (HMX3), mRNA.
ACCESSION   NM_001007985 XM_426755
VERSION     NM_001007985.1
KEYWORDS    RefSeq.
SOURCE      Gallus gallus (chicken)
  ORGANISM  Gallus gallus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Archelosauria; Archosauria; Dinosauria; Saurischia; Theropoda;
            Coelurosauria; Aves; Neognathae; Galloanserae; Galliformes;
            Phasianidae; Phasianinae; Gallus.
REFERENCE   1  (bases 1 to 927)
  AUTHORS   Herbrand H, Guthrie S, Hadrys T, Hoffmann S, Arnold HH,
            Rinkwitz-Brandt S and Bober E.
  TITLE     Two regulatory genes, cNkx5-1 and cPax2, show different responses
            to local signals during otic placode and vesicle formation in the
            chick embryo
  JOURNAL   Development 125 (4), 645-654 (1998)
   PUBMED   9435285
COMMENT     PROVISIONAL REFSEQ: This record has not yet been subject to final
            NCBI review. The reference sequence was derived from Y15989.1.
            On Dec 17, 2004 this sequence version replaced XM_426755.1.
FEATURES             Location/Qualifiers
     source          1..927
                     /organism="Gallus gallus"
                     /mol_type="mRNA"
                     /db_xref="taxon:9031"
                     /chromosome="6"
                     /map="6"
     gene            1..927
                     /gene="HMX3"
                     /gene_synonym="NKX5-1"
                     /note="H6 family homeobox 3"
                     /db_xref="CGNC:16346"
                     /db_xref="GeneID:429199"
     CDS             1..927
                     /gene="HMX3"
                     /gene_synonym="NKX5-1"
                     /note="NK homeobox; homeo box (H6 family) 3; cNkx5-1;
                     homeobox protein Nkx-5.1; homeobox protein H6 family
                     member 3; homeobox (H6 family) 3"
                     /codon_start=1
                     /product="homeobox protein HMX3"
                     /protein_id="NP_001007986.1"
                     /db_xref="CGNC:16346"
                     /db_xref="GeneID:429199"
                     /translation="
MPETGQEPPSAPPPPPPPKESFYIKNLLNGDPPKAAPKQPRALFAPSGKADGSGFALSQVGDLSFPRFEIPAPRFALSAHCLERAQTWWYPYALTPAGAHLPRTEAAEKSLLRDSSPASGTDRDSPEPLLQGGDAEQKERDPKSPAEIVLEESDSEEGKKEGGAEDWKKREESPEKKPCRKKKTRTVFSRSQVFQLESTFDMKRYLSSSERAGLAASLHLTETQVKIWFQNRRNKWKRQLAAELEAANLSHAAAQRIVRVPILYHENSGAESSAAGGGGPGPQPLLTFPHPVYYSHPSVTSVPLLRPV"
     misc_feature    <361..534
                     /gene="HMX3"
                     /gene_synonym="NKX5-1"
                     /note="ASF1 like histone chaperone; Region:
                     ASF1_hist_chap; cl22451"
                     /db_xref="CDD:304562"
     misc_feature    order(544..558,562..564,613..615,631..633,670..672,
                     676..681,688..693,697..705,709..714)
                     /gene="HMX3"
                     /gene_synonym="NKX5-1"
                     /note="DNA binding site [nucleotide binding]"
                     /db_xref="CDD:238039"
     misc_feature    550..711
                     /gene="HMX3"
                     /gene_synonym="NKX5-1"
                     /note="Homeobox domain; Region: Homeobox; pfam00046"
                     /db_xref="CDD:278475"
     misc_feature    order(550..552,559..561,679..681,688..693,700..702)
                     /gene="HMX3"
                     /gene_synonym="NKX5-1"
                     /note="specific DNA base contacts [nucleotide binding];
                     other site"
                     /db_xref="CDD:238039"
     exon            1..316
                     /gene="HMX3"
                     /gene_synonym="NKX5-1"
                     /inference="alignment:Splign:2.1.0"
     exon            317..927
                     /gene="HMX3"
                     /gene_synonym="NKX5-1"
                     /inference="alignment:Splign:2.1.0"
ORIGIN      
atgccggagaccgggcaggagccgcccagcgccccgccgccgccgccccctcccaaggagtccttctacatcaagaacctgctcaacggagacccccccaaagcggcccccaagcagccgagggctctgttcgccccttcgggcaaagcggacggctccggcttcgccctctcgcaggtgggagatctctcctttccccgcttcgagatcccggcgccgcgcttcgctctgagcgcgcactgcctggagcgagcccagacctggtggtacccctacgcgctgacgccggccggagcccacctgccccgcaccgaagccgcggagaaatccctcctgcgggactcgtcccccgcgtcgggcaccgacagggactccccggagccgctgctccaggggggggacgcggaacagaaggagcgggaccccaagagccccgccgagatcgtgctggaggagagcgactcggaggaggggaagaaggagggcggcgcggaggactggaagaagcgggaggagagccccgagaagaagccgtgccgcaagaagaagacgcgcacggtgttcagccgcagccaggtcttccagctcgagtccaccttcgacatgaagcgctacctgagcagctcggagcgggccggcctggccgcttcgctgcacctcacagagacccaggtgaagatctggttccagaaccgccgcaacaagtggaagcggcagctggcggccgagctggaggcggccaacctcagccacgcggccgcgcagcgcatcgtgcgcgtccccatcctctaccacgagaactcgggcgcggagagcagcgcggcgggaggcggcggccccggcccgcagcctctgctcaccttcccccaccccgtttattactcccaccccagtgtcacctccgtaccgctcctgcggcccgtctga
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]