GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2020-11-27 00:32:11, GGRNA.v2 : RefSeq release 202 (Sep, 2020)

LOCUS       NM_001005427            1891 bp    mRNA    linear   VRT 25-JUN-2020
DEFINITION  Gallus gallus mesenchyme homeobox 2 (MEOX2), mRNA.
ACCESSION   NM_001005427 XM_418692
VERSION     NM_001005427.1
KEYWORDS    RefSeq.
SOURCE      Gallus gallus (chicken)
  ORGANISM  Gallus gallus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Archelosauria; Archosauria; Dinosauria; Saurischia; Theropoda;
            Coelurosauria; Aves; Neognathae; Galloanserae; Galliformes;
            Phasianidae; Phasianinae; Gallus.
REFERENCE   1  (bases 1 to 1891)
  AUTHORS   Reijntjes S, Stricker S and Mankoo BS.
  TITLE     A comparative analysis of Meox1 and Meox2 in the developing somites
            and limbs of the chick embryo
  JOURNAL   Int. J. Dev. Biol. 51 (8), 753-759 (2007)
   PUBMED   17939123
  REMARK    GeneRIF: In the limb bud, Meox1 is co-expressed with Meox2 but
            neither Meox gene is co-expressed with MyoD, suggesting that these
            two genes have overlapping and distinct functions in development
REFERENCE   2  (bases 1 to 1891)
  AUTHORS   Rallis C, Stamataki D, Pontikakis S, Mankoo BS and Karagogeos D.
  TITLE     Isolation of the avian homologue of the homeobox gene Mox2 and
            analysis of its expression pattern in developing somites and limbs
  JOURNAL   Mech. Dev. 104 (1-2), 121-124 (2001)
   PUBMED   11404088
COMMENT     PROVISIONAL REFSEQ: This record has not yet been subject to final
            NCBI review. The reference sequence was derived from AJ401088.1.
            On Oct 4, 2004 this sequence version replaced XM_418692.1.
            
            ##Evidence-Data-START##
            Transcript exon combination :: AJ401088.1, BU127007.1 [ECO:0000332]
            ##Evidence-Data-END##
FEATURES             Location/Qualifiers
     source          1..1891
                     /organism="Gallus gallus"
                     /mol_type="mRNA"
                     /db_xref="taxon:9031"
                     /chromosome="2"
                     /map="2"
     gene            1..1891
                     /gene="MEOX2"
                     /note="mesenchyme homeobox 2"
                     /db_xref="CGNC:8206"
                     /db_xref="GeneID:374137"
     exon            1..551
                     /gene="MEOX2"
                     /inference="alignment:Splign:2.1.0"
     misc_feature    26..28
                     /gene="MEOX2"
                     /note="upstream in-frame stop codon"
     CDS             41..949
                     /gene="MEOX2"
                     /function="Antennapedia-like homeobox containing gene"
                     /note="mesenchyme homeo box 2 (growth arrest-specific
                     homeo box)"
                     /codon_start=1
                     /product="homeobox protein MOX-2"
                     /protein_id="NP_001005427.1"
                     /db_xref="CGNC:8206"
                     /db_xref="GeneID:374137"
                     /translation="
MDHTLFGCLRSPHATAQSLHPFSQSSLALHGRSDHMSYPDLSSSSSSCIITGYPNEEGMFASQHHRGHHHHHHHHHHHHQQQQHQALQTNWHIPQMSSPPAAARHSLCLQPDSGGPPELGSSPPVLCSNSSSLGTTTPTGAACAPGDYGRQALSPVETEKRSGKRKSDSSDSQEGNYKSEVNSKPRKERTAFTKEQIRELEAEFAHHNYLTRLRRYEIAVNLDLTERQVKVWFQNRRMKWKRVKGGQQGAATPEKELVNVKKGTLLPSELSGIGAAGLQHTGDSLANDDSHDSDHSSEHAHL"
     misc_feature    509..853
                     /gene="MEOX2"
                     /note="Homeodomain-containing transcription factor
                     [Transcription]; Region: COG5576"
                     /db_xref="CDD:227863"
     misc_feature    order(596..610,614..616,665..667,683..685,722..724,
                     728..733,740..745,749..757,761..766)
                     /gene="MEOX2"
                     /note="DNA binding site [nucleotide binding]"
                     /db_xref="CDD:238039"
     misc_feature    order(602..604,611..613,731..733,740..745,752..754)
                     /gene="MEOX2"
                     /note="specific DNA base contacts [nucleotide binding];
                     other site"
                     /db_xref="CDD:238039"
     misc_feature    605..763
                     /gene="MEOX2"
                     /note="Homeobox domain; Region: Homeobox; pfam00046"
                     /db_xref="CDD:278475"
     exon            552..724
                     /gene="MEOX2"
                     /inference="alignment:Splign:2.1.0"
     exon            725..1891
                     /gene="MEOX2"
                     /inference="alignment:Splign:2.1.0"
ORIGIN      
ttcctaaactctcctgcctggaacctgagacttgcatgccatggatcacacactctttggctgcctgcgcagcccccatgccaccgcgcagagcttgcatcctttctcccagtcttctcttgccctgcatggaagatccgaccacatgtcctaccccgatctgtcttcttcttcttcctcttgcataataacgggataccccaatgaggagggcatgtttgccagccagcatcatagggggcaccaccaccaccaccatcaccaccaccatcaccaccagcaacagcagcaccaggctttgcagacgaactggcacatccctcagatgtcgtctcctcccgccgcggccaggcacagcctctgtctccagccggactcaggaggacccccggagctgggcagcagcccccccgtgctgtgttcgaactcctccagcctgggcactaccacccccacgggggcagcgtgtgcgccgggggactatggcaggcaggctctgtccccggtggaaacggagaagaggtccggcaagaggaaaagcgacagttcagattcccaagaaggaaactacaagtcagaggtcaacagtaaacccaggaaggaaaggacagctttcaccaaggagcaaatcagagagctagaagcagaatttgctcatcataactatttgaccaggctgaggagatatgagatagcagtaaaccttgacctcactgaaagacaggtaaaagtttggttccagaacagacggatgaaatggaagcgggtaaaaggaggccagcaaggggcagcaaccccggaaaaggaactggtgaatgtgaaaaaaggcacgctgctcccctccgagctctctggcattggggcagctggtctccaacacacgggggactcactagcgaatgatgacagccacgacagcgatcacagctctgagcacgcacacttatgatacacagagagtgtcccagctccgttctcaggaaagatgctttgctggcaagccttacacaggcatcgtttacgtatgcaagtgactggcagtgatttttaaagttgttatggaagattcaggcttattgtgtctgtttttcttgatttttagatggtttacagtaagtgcatgtcttaaaggtgcctcaagagtggagaagtggaagatgaactttgaacattccagatttgtttgtgatgtttatgacagcgggcaggtattttcctttagcttgcactgaaaattacattgctctcaacagacgttatatctgaaaaccacagtgccacaaaatcactatttagtggataagaaatgtattttaactctgtatatatttaccttacagcattttcctgtcttcactaattttagcaatgcattcatattagctgatggcaatagtcactcatgacaataaatggctttttgtctctttaatttttgttttgtttcgccaaagacatccaatacatgcagatacttttgttcaagtagagaaggtatctgctaggacacgtccttgtatgacagacaaaacaaacattatgttgcatttactatcaactgctgctaatagggtattattaaacttacctagctcctcaattcttcttatcttataactgcaaaaaaatgatttttaggatcataaggatagtccagtaacctgccacaaaattttcatgctcagtggaaaccccagaaaggattattcatttctactttgtcatcactgagtacattaatactgactctgcggaaatgtctcttcatcttcagtttaaaaaacagcagtcagctgagttattatcaactgcttatgttggtaggaatcaaaatatgaaggtaactcagtattgtgtcccgtgtgtaaaatgaagacatattttctgttat
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]