2024-05-20 11:26:34, GGRNA.v2 : RefSeq release 222 (Jan, 2024)
LOCUS XM_039087237 27323 bp mRNA linear ROD 11-JUN-2023 DEFINITION PREDICTED: Rattus norvegicus obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF (Obscn), transcript variant X18, mRNA. ACCESSION XM_039087237 VERSION XM_039087237.1 DBLINK BioProject: PRJNA677964 KEYWORDS RefSeq. SOURCE Rattus norvegicus (Norway rat) ORGANISM Rattus norvegicus Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha; Muroidea; Muridae; Murinae; Rattus. COMMENT MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NC_051345.1) annotated using gene prediction method: Gnomon, supported by mRNA and EST evidence. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI RefSeq Annotation Status :: Updated annotation Annotation Name :: GCF_015227675.2-RS_2023_06 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 10.1 Annotation Method :: Best-placed RefSeq; Gnomon; cmsearch; tRNAscan-SE Features Annotated :: Gene; mRNA; CDS; ncRNA Annotation Date :: 06/06/2023 ##Genome-Annotation-Data-END## FEATURES Location/Qualifiers source 1..27323 /organism="Rattus norvegicus" /mol_type="mRNA" /strain="BN/NHsdMcwi" /db_xref="taxon:10116" /chromosome="10" /sex="male" /tissue_type="kidney" /country="USA: Wisconsin, Milwaukee, Medical College of Wisconsin" /collection_date="2019-03-08" /collected_by="Rebecca Schilling" gene 1..27323 /gene="Obscn" /note="obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF; Derived by automated computational analysis using gene prediction method: Gnomon. Supporting evidence includes similarity to: 1 mRNA, 25 ESTs, 27 Proteins, and 100% coverage of the annotated genomic feature by RNAseq alignments, including 5 samples with support for all annotated introns" /db_xref="GeneID:338458" /db_xref="RGD:631335" CDS 186..27269 /gene="Obscn" /codon_start=1 /product="obscurin isoform X18" /protein_id="XP_038943165.1" /db_xref="GeneID:338458" /db_xref="RGD:631335" /translation="
MDHSFSGAPRFLTRPKAFVVSVGKDATLSCQIVGNPTPHVSWEKDRQPVEAGARFRLAQDGDVYRLTILDLALGDSGQYVCRARNAIGEAFAAVGLRVDSEGTCAEQAPHFLLRPTSIRVREGADATFRCRVGGSPQPAVSWSKDGRRLGAPDAPHVRVEDRGEASALRIRSARPRDGGTYEVRAENPLGSASAAAALVVDSDAEAAGPPGTSVATLLAHLQQRREAMRAEGVPPSPPGAGTRTCTVTEGKHARLSCFVTGEPKPETVWKKDGQLVNEGRRHVVYEDEQENFVLKILFCKQSDRGLYTCTASNLVGQTYSSVLVVVREPAVPFKKRLQDLEVREKESATFQCEVAQPATEAAWFKEETRLWASAKYDIEEEGTERRLTVRNVSADDDAVYICETTEGSRTVAELSVKGNLTRKLPRKTAVRTGDTAIFWVELAVPEGPVQWLRNQEEMVAGGRIAITAEGTCHTLTIFQCTLEDMGEVAFVAGGCRTTTQFCVSAPRRPPLYPPADPVVKAKTESSVTLSWSPPPHGDRPVTIDGYVVEKRKLGAYAWSRCHEAEWLATTEFTIAGVAEEGDFQFRVSAINHFGHSPYLEFPGTMHLVPTLAVKTPLKAVEAMEGGEVTFSVDLTVASSGEWFLDGKALKESSTYVIRCDRTRHMLTIREVPASLHGAQLKFVANGIETSIQMVVRGALGLPSNKLPAVAAREVLAQLHEEAQLLAELSDQAAAVTWLKDGRELSLGPKYEMQVSAGKQALLVRDVAQDDAGLYECVSRGSRITYQLLVQEANLMFAKKQQARSEVKAEVGASATLSCEVAQAQTEVTWFKDGKKLSSSSKVRMEASGCSRRLVVQQVGKADAGEYSCEAGGQKVSFRLDVTEPKVVFAKGQQSHSKVKAEAGANATLSCEVAQAQTEVTWFKDGKKLSSSSKVCVEASGCSRRLVVQQAGKADAGEYSCEAGGQKVSFCLDVAEPKVVFAKEQQARSEVKAEAGASATLSCEVAQAQTEVSWFKDGKKLSSSSKVRMEASGCSRRLVVQQAGKADAGEYSCEAGGQKVSFRLDVTEPKVVFAKEQQARSEVKAEAGANATLSCEVAEAQTEVSWFKDGKKLSSSSKLRVEASGCSRRLVVQQAGKADAGEYSCEAGGQKVSFRLDVTEPKVVFAKEQQARSEVKAEAGASATLSCEVAQAQTEVTWFKDGKKLSSSSKVRVEASGCSRRLVVQQAGKADAGEYSCEAGGQKVSFRLDVAEPKVVFAKEQQARSEVKAEAGASATLSCEVAQAQTEVTWFKDGKKLSSSSKVRVEASGCSRRLVVQQAGKADAGEYSCEAGGQKVSFRLDVAEPKVVFAKEQQARSEVKAEAGASATLSCEVAQAQTEVTWFKDGKKLSSSSKVCVEASGCSRRLVVQQAGKADAGEYSCEAGGQKVSFRLDVAEPKLVFAKEQQARSEVKAEAGASATLSCEVAQAQTEVTWFKDGKKLSSSSKVRVEASGCSRRLVVQQAGKADAGEYSCEAGGQKVSFRLDVPEPKVVFAKEQQARSEVKAEAGASATLSCEVAQAQTEVTWFKDGKKLSSSSKVRVEASGCSRRLVVQQAGKADAGEYSCEAGGQKVSFRLDVTEPKLVFAKEQQARSEVKAEAGASATLSCEVAQAQTEVTWFKDGKKLSSSSKVRVEASGCSRRLVVQQAGKADAGEYSCEAGGQKVSFRLDVTEPKVVFAKEQQARSEVKAEAGASATLSCEVAQAQTEVSWFKDGKKLSSSSKVRVEASGCSRRLVVQQAGKADAGEYSCEAGGQKVSFRLDVAEPKVVFAKEQQACSEVKAEAGASATLSCEVAQAQTEVIWFKDGKKLSSSSKVRVEASGCSRRLVVQQVGKADAGEYSCEAGGQKVSFRLDVPDTKLMFAKEQQACSEVKAEAGASATLSCEVAQAQTEVTWFKDGKKLSSSSKVRVEASGCSRRLVVQQAGKADAGEYSCEAGGQKVSFRLDVAEPEPESQTPQRPSRREPLVIKEHETIVLSATIAAPSVAAVTWLKDGVEIRRSKRHETTSVGDTHTLTVRGAQVLDSAIYSCRVGKEGQDFPVQVEEVATKFSKPLEPVEGELGGTVTLVCELSPEQAEVVWRCGSTQLRAGKRFQMTAEGSRRTLTVSGLREDDAEEYVCESRDDRTSARLTVKVPRVVKFTSGLSAMAAEEGQEATFQCVVSPSDAAVMWYKDGTQLQPSEKFVMVQSGASRSLTILGLTLEDAGHVTVEAEGASSSAALRVREAPVLFKKKLEPQTVEERTPVTLEVELTRPWPEVKWTRNAAVLVPSENVEIHAEGARHRLVLRSVGFADRGFFGCETPDDKTQAKLNVEMRQVRLVRGLQEVEAKEQGTASMDVELSHADVEGSWTRDGLRLQPGPKCHLAVQGPVHILTLSALQPQDSGLVAFRAEGVHTSARLIVTELPVSFTRLLQDVVATQKEKVTLECELSRPVDVRWLKDGVELRAGKAIGIVAQGTCRSLVIYRCETGDQGVYVCDALDAQTSASLRVQGRSVQIMKPLEDVEVMEKEGATFSCEVSHDEVPGIWFREATKLRPSDNVRIRQEGRTYTLIFRRVLAEDAGEIKFVAENAESRAHLRVKELPVTLLRPLRDKIAMEKHRGVLECQVSRASAQVRWFKGKVELQPGPKYEVVSDGLYRKLVINDVQPEDEDTYTCDAGDVKTSAQFFVEEQSITIVRGLKDMTVMEPAPAWFECETSIPSVRPPKWLLGKTVLQAGGNVGLEQDGTVHRLTLHKTCSTMTGPVHFTIGKSRSTAQLVVSDIPVVLTRPLEPKAGRELQSVVLSCDFRPAPKAVQWYKEDTPLSPSEKFKMVLEGQMAELRILRLTPADAGVYRCQAGSAQSSAEVTVEAREVTVIQPLQDVEAMEEGRVCFSCELSHKDEDIEWSLNGTPLYSDSFHEISHEGCLHTLVLKSVRQADTGTVCATSPKVSVSARLVVKAKPVVFLKALDDVSAEERGTLTLQCEVSDPEARVVWRKDGVELGPSDKYDFLHKAGVRSLTVHDMSHEDAGLYTCQVGSKETQSRVSVHDLHVGITKRLKTVEVLEGESCSFECVLSHESPSDPAVWTVGGKIVRSSDHFQAVRQGRKYTLTVKDAALSDAGEVVFSVLGLTSKASLIIREKPVDITKPLEDQHTTPGEDVMLSCELSRAGSSVRWLKDGKAIRKSQKYDLLIEGTQAVLVVRKASLKDSGEYTCETEASRSTARLCVEEKTNRFTEELADLQVEEKGRAVFTCKTEQPASIVTWRKGLLELRASGKHVPSQEGLTLTLTINALERTDSDTYTCDIGQARTQARLLVHGQKVRVIEDLEDTAVQEGSSAKFCCRISPADYGPVHWFLDKTPLHSNELNEITVQSGGYHVLTLRQLTLKDSGTVYFEAGDQRTSAALRVTEKPSIFSRPLTDVTVTEGEDLTLVCETTTPDSSVRWTKDGKTLRPSARCQLNREGCQAQLVITGTTLQDGGRYKCEVGGASSSSIVRVHARPVRFRESLKDMEVPEGKAATLRCVLSSVAAPVEWRHGDDVLKSSNKYSLRQEGAVLELVIRDLKPQDSGQYSCSFGDQTTSATLTVKTSSAQFIGKLRNKEATEGTMATLRCELTKEAPVEWKKGTETLRNGDKYSLKQDGAVCELQICNLLVADAGEYLCVCGQEKTSATLTVKAVPVHFIRRLRNKEATEGDTVTLQCELSKAAPVEWRKGTETLRDGDRYSLKQDGAVCELQIRSLAVADAGEYLCMCGQEKTSATLTIRALPAKFIESLKNEGATEGTTATLSCKLSKAVPVTWKRGTKTLRDGDKYGLRQDGAVCELQIRGLTTADAGEYSCVCGQEKTSAALTVKGLPAKFIEDLRSQEAMEGATAILRCELSKAAPVEWRKGSKILEDGDRYTLRQDGAVCELQIRGLAVVDTGTYSCVCGQEKTSATLNINALPAKFTEGLRNEESMEGTMVTLRCQMSKVTPVEWRKGSETLRDGGRYSLRQDGAVCELQIRGLILEDAGEYSCVCGQEKTSATLSVKALPPRFIEDLRSQEAMEGTMVTLRCQMNKAAPVEWRKGSETLRDGGRYSLRQDGAGCELQIHRLALEDAGEYSCVCGQEKTSATLSVKALPPRFIEDLRSQEATEGTMVTLRCQMNKAPSSTVEWRKGSESLRDGGRYSLRQDGAVCELQIRGLTLEDAGEYSCVFGQERTSATLSVKALPPRFIEDLGSQEAMEGTMVTLRCQMSKTAPVEWRKGSETLRDGGRYSLRQDGALCELQIHRLALEDAGEYSCVCGQEKTSATLSVKALPPRFIEDLRSQKATEGTMVTLRCQMSKVAPVEWRKGSESLRDGDRYSLRQDGAMCELQICGLAVEDSGEYSCVCGQERTSATLTVDALPPKFTEGLKKEEATEGNMATLRCQMSKAAPVEWRKGSETLRDGGRYSLRQDGAACELQIRGLALEDAGEYSCLCGQEKTSATLSVKALPPRFIEDLRSQEATEGNMVTLRCQMSKVTPVEWRKGSETLRDGGRYSLRQDGAVCELQIHRLALEDAGEYSCLCGQEKTSATLSVKALPPRFTEDLRSQKATEGTMVTLRCQMSKAAPVEWRKGSETLRDGGRYSLRQDGAVYELQIRGLALEDAGEYSCVCGQEKTSATLSVKALPARFIEDLRSQEVPESSTVTMRCELSKKAPVVWRKGSETLKNGARYSLRQDGAVCELEIRDLTVEDAGEYSCTCGKERTSATLSIMAPQVVFQKLLENLQAEEGSTASLRCELSVPNTAVVWSKGGLELQADTCRETRQQGCVAELLLRDVRREDAGEYSCTCGSQTTSATLMVTAAPVRFLQELQAQDVDEGTTARLRCELSREAASVEWRKGSLQLFPCAKYQMVQEGTTAELLVHGVEQEDAGEYTCDAGHMQSIARLSVRAPKPKFKTGLQSKEQEAGGTARLCCQLSEAESGTPVQWLKEGVELHVSSKYEMRCQGAMCELLIHKLEAKDTGEYACVVGGQKTLASLRVKEPEVTIVQGLVDMEVQADEDVEFTCKVSQAGATDVQWHLQGLPLQSNEVTEVAVLGDGCTHVLQLKGVTLDDAGTVSFHVGSHSSSAQLIVRVPEVTVLEPLKDVQLSEGQDAHFQCRLSRASGQEARWALGGVPLQCNEMNDITVEQGTLYSLTLHKVTLEDAGTITLQVGSCSSEAQLKVTEAALCLVRGLQNVDVFAGEVATFSCEVSRAGGPEARWWLDGTLLQNSPESAMTVREGTVHSLTLSGLGVADSGTITFRTGPLVSTAKLLVKDPTVEVVSAMQDLVVEEGGSAELLCQYSRPVQAMWKMNEREVCADGHRVIIEQDWTVARLTLRPALPCDSGIYSCEAAGTRVVALLQVQAKNTVVRGLENVDALEGGEALFECQLSQPEVAAHTWLLDDEPVHTSANVEVVYFENGLRHLLLLKNLKPQDSCRVTFLAGDVVTSAFLTVRGWRLEVLEPPQDASVKAGTQVCFTCILSEALPVGEATWYINGAAIQPDDADWIVTADGSHHALTLSNAQPQHAGEVTFAARDAVASARLSVLALPGPPEDAEVVGRSDHSVTLSWVAPVSDGGGGLCGYRVEMKEASTGQWQLCHELVPGPECVVDGLVSGKTYRFRVAAVGPAGAGEPVHLPQMVKIAEPMEPKPAPAPAPALAPTPAPIPTPAPAPAPAPTPAPTPTPAPAPAPAPAPATRRAVVGEDVCLELEVAADAGEVVWHKGTERIHPSGHFEVLSQGQRQMLVIKGFRTEDQGEYRCGPIQGLPSSGASTFNVVVTSGSEDEVPAQPSLPPEAAQEGDLHLLWEALARKRRMSREPTLDSISELPEEDSRVQHLRQEAEEAAPDLSEGYSTADELARTGEADLSHTSSDDESRAGTPSLITYLKKAGGPGISPLASKHEAQVATSVKPQKQQERVVPTCPLPGDLNAADLKDPSLDKAAVKIQAAFKGYKVRKEMKQQGGPVFSRTFGDTEAQVGDALRLECVVSTKADVRACWLKDGVELTDGRHYHIDQLKDGTCSLLVTGLGPTDSGRYTCQVSTKFGSVSHSACVMVSGTESEAESSSGGELDDAFRRAARRLHRLFRTKSPAELSEEELFLSADEGPMEPEEPADWQTYREDENFVCIRFESLAEAHRAVTCFRDMFATMGIGVEISLGEQGPRGVEMRIGKVAPTVIPAVPLAKTPGLQTSDAAPVFLTELQNQDVQDGYPMSFDCVVTGQPVPSVRWFKDGKLLEEDDHYMINEDQQGGHQLIITAVVPADMGVYRCLAENSMGVSSTKAELRVELTSTDYDTAADATETSSYFSAQGYLSSREQEGTESDEGQLPQVLEELKDLQVAPGTRLAKFQLKVKGYPAPKLYWFKDGQPLTTSDHIRMTDKKTLHTLEIVSITREDSGQYAAYISNAVGAAYSSARLLVRGPSEPEEKPQPDVHERLVPPRILEKFTPKKVKRGSSITFSVKVEGHPAPSVHWLKEEAEKGVLWIGPDTPGYTMASSSKQHSLVLLDVGRQHQGTYTCIATNAAGQALCSASLHISGLAKEEEQERVKEALISSFLQGTSQAVSAQMSESASFADLVGQRKGESLVAEEAHSHLSLSEVGTEEFLQKLTSQITEMVSAKISQAKLQVPGGDSDEESKTPSASPRHGRSRPSSSVQESSSESEDGDSRGEIFDIYVVTADYLPLGAEQDAIILREGQYVEVLDSAHPLRWLVRTKPTKSSPSRQGWVSPAYLDKRLKLSPEWGPTEAPEFPGEAVSEDEYRTRLSSVIQELLSSEQAFVGELQFLESHHIKHLDRSPRVPAAVASQKTVIFRNVQDISHFHSSFLKELQSCGTDDDVAMCFIKNQEAFEKYLEFLVGRVQAESVVVSTPVQEFYKKYAEEMLSAKDPTQPPPPPLQHYLEQPVERVQKYQALLKELIRNKARNRQNCALLEQAYAVVSALPQRAENKLHVSLMENYPGTLEALGEPIRQGHFIVWEGAPGARMPWKGHNRHVFLFRNHLVICKPRRDSRTDTFSYVFRNMMKLNSIDLNDQVEGDDRAFEVWHEREDSVRKYLLQARTVIIKNSWVKEICGIQQRLAQPVWRPPEFEEELADCTAELGETVKLACRVTGTPKPIVSWYKDGKPVEVDPHHILIEDPDGSCTLILDNLTGIDSGQYMCFAASAAGNASTLGKILVQVPPRFVNKVRATPFVEGEDAQITCTVEGAPYPQIRWYKDGALLTLGNRYRMVNEPRSGMLVLVIQAASKEDLGHYECELVNRLGSTRCGGELYMQSPALRAWDQHHREQLVAAVEDASMEDSAHPTQEGADQQAASVLWRLLGSEALSPSPGGFPNTRQSEPPTSEEAAPQIPGTTSGTPGKLPEASRPGTYKGLEQGMTTTSGSQERNVPIRVEGTAWPGGGTGQLLLDVHSQVIMETTQRTYVCQAPDTGVTRAPSMQVTIEDLQVQVGDMAQFDAVIEGNPPPTVTWYKDSNQLVNGTRLRQQQGGTTYSLVLMDVTPHDAGVYTCVAQNAGGQVLCKAELLVYGGDKSDAEKQAYRRKLHSFYEVQEEIGRGVFGFVKRVQHKGNKMSCAAKFIPLRSKTRAQAYQERDILATLSHPLVTGLLDQFETQKTLILILELCSSEELLDRLFKKAVVTEAEVKVYIQQLVEGLHYLHSHDILHLDIKPPNILMVHPAREDIKICDFGFAQKITPSEPQYSKYGSPEFVSPEIIEQSPVSEGSDIWAMGVISYLSLTCSSPFAGESDRATLLNVLEGRVSWSSPMAAHLSEDAKDFIKATLQKTPRARPSASQCLAHPWFLKSMPAEEAHFINTKQLKFLLARSRWQRSLMSYKSILVMRSIPELLQGPPDSPSLGVARHLRGEASGSSSSSSSSDNELAPFARAKSLPPSPVTHSPLLHPRGFLRPSASLPEETEASMSTADAAMPAPPQSAGPPASPGCVPRHSVISSLFYQQAGEGAERGSKALGAKRHPARRRHLLKGGYIARALPGLREPLMEFSVLEEEAANEEQASLMTKTPSFETALRLPSSNVREVPGRSRSLDNPPGTASPSPEAYKEQYLSPPSSGLTHETTAKGMGHKEGFLQESVPFSPTSGDLRPVKQEGSSQDSCRGKPASSCHSELGSGPQEGCGSPSSQLCGSLPPQSSKKELSKPCGPLFSEQPQAAPFPAQASPLLGSQKEPQDSYLPEKPCPVPSSSPGSASQVDASLDTEGLSEAGDTCDFTPPLQRPQEQATTRKFSLESRGGYAGVAGYGTFAFGGDAGGMLGQGPLWARMAWAVSQSSEEQDEAATESPQPLDSSGPIAEASGVPLRTSPSLTPWEEVEQVSLVQIRDLSGDAEAADTISLDISEVDPAYLNLSDLYDIKYLPFEFMIFRRVPKPVEQPESPGSETEEGQGLAEFLEEAVWPWPGELGLRAGLEITEEPQEPGDLEALLGEAAVGRKRKWSPSRGLFQFPGRCLSGEEPVELGLRQRVKASMAHISRILKGKPEGPEKEGPPRKKAGLASFRLSGLKGRDQAPSFLRELSDEAVVLGQSVTLACQVLAQPTAQATWSKDGALLESSGHLLISSTLKNFQLLTILVVTEEDLGTYTCCVSNPLGTAVTTGVLRKAERPSSSPRPEVGELYTDAVLLVWKPVESYGPVTYIVQCCIEGGSWTTLASDISDCCYLTGKLPRGGMYTFRTACVSKAGMGPYSSPSEQVLLGGPNHLASEEESSRGRPAQLLPSTKTFAFQTQIRRGRFSVVRQCREKASGRALAAKIVPYQPEDKTTVLREYEALKRLHHPHLAQLHAAYLSPRHLVLILELCSGPELLPSLAERDSYSESDVKDYLWQMLSATQYLHAQHILHLDLRSENMMVTEYNLLKVIDLGNAQSLSQEKVPPPENFKDYLETMAPELLEGQGAVPQTDIWAIGVTAFIMLSGEYPVSSEGTRDLQKGLRKGLIQLSRCYAGLSGGAVAFLQSSLCARPWGRPCASTCLQCGWLTEEGPTGSRPTPVTFPTARLRAFVREREKRRALLYKKHNLAQVR"
misc_feature 210..479 /gene="Obscn" /note="Immunoglobulin I-set domain; Region: I-set; pfam07679" /db_xref="CDD:400151" misc_feature 261..275 /gene="Obscn" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 300..314 /gene="Obscn" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 366..380 /gene="Obscn" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 417..434 /gene="Obscn" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 510..785 /gene="Obscn" /note="Immunoglobulin I-set domain; Region: I-set; pfam07679" /db_xref="CDD:400151" misc_feature 561..575 /gene="Obscn" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 600..614 /gene="Obscn" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 681..695 /gene="Obscn" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 723..740 /gene="Obscn" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 921..1163 /gene="Obscn" /note="Immunoglobulin I-set domain; Region: I-set; pfam07679" /db_xref="CDD:400151" misc_feature 942..956 /gene="Obscn" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 981..995 /gene="Obscn" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 1059..1073 /gene="Obscn" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 1101..1118 /gene="Obscn" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 1140..1151 /gene="Obscn" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" misc_feature 1182..1433 /gene="Obscn" /note="Immunoglobulin domain; Region: Ig; cl11960" /db_xref="CDD:448366" misc_feature 1227..1241 /gene="Obscn" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 1263..1277 /gene="Obscn" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 1338..1352 /gene="Obscn" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 1380..1397 /gene="Obscn" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 1452..1661 /gene="Obscn" /note="Immunoglobulin domain; Region: Ig; cl11960" /db_xref="CDD:448366" misc_feature 1491..1505 /gene="Obscn" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 1527..1541 /gene="Obscn" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 1602..1616 /gene="Obscn" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 1644..1661 /gene="Obscn" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 1671..1682 /gene="Obscn" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" misc_feature 1722..1985 /gene="Obscn" /note="Fibronectin type 3 domain; One of three types of internal repeats found in the plasma protein fibronectin. Its tenth fibronectin type III repeat contains an RGD cell recognition sequence in a flexible loop between 2 strands. Approximately 2% of all...; Region: FN3; cd00063" /db_xref="CDD:238020" misc_feature order(1968..1973,1977..1982) /gene="Obscn" /note="Cytokine receptor motif [active]" /db_xref="CDD:238020" misc_feature 2028..>2198 /gene="Obscn" /note="Immunoglobulin domain; Region: Ig; cl11960" /db_xref="CDD:448366" misc_feature 2313..2552 /gene="Obscn" /note="Immunoglobulin domain; Region: Ig; cl11960" /db_xref="CDD:448366" misc_feature 2349..2363 /gene="Obscn" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 2385..2399 /gene="Obscn" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 2460..2474 /gene="Obscn" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 2502..2519 /gene="Obscn" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 2529..2540 /gene="Obscn" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" misc_feature 2583..2828 /gene="Obscn" /note="Immunoglobulin domain; Region: Ig; cl11960" /db_xref="CDD:448366" misc_feature 2625..2639 /gene="Obscn" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 2661..2675 /gene="Obscn" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 2736..2750 /gene="Obscn" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 2778..2795 /gene="Obscn" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 2805..2816 /gene="Obscn" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" misc_feature 2859..3104 /gene="Obscn" /note="Immunoglobulin domain; Region: Ig; cl11960" /db_xref="CDD:448366" misc_feature 2901..2915 /gene="Obscn" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 2937..2951 /gene="Obscn" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 3012..3026 /gene="Obscn" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 3054..3071 /gene="Obscn" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 3081..3092 /gene="Obscn" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" misc_feature 3135..3380 /gene="Obscn" /note="Immunoglobulin domain; Region: Ig; cl11960" /db_xref="CDD:448366" misc_feature 3177..3191 /gene="Obscn" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 3213..3227 /gene="Obscn" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 3288..3302 /gene="Obscn" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 3330..3347 /gene="Obscn" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 3357..3368 /gene="Obscn" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" misc_feature 3411..3656 /gene="Obscn" /note="Immunoglobulin domain; Region: Ig; cl11960" /db_xref="CDD:448366" misc_feature 3453..3467 /gene="Obscn" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 3489..3503 /gene="Obscn" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 3564..3578 /gene="Obscn" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 3606..3623 /gene="Obscn" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 3633..3644 /gene="Obscn" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" misc_feature 3687..3932 /gene="Obscn" /note="Immunoglobulin domain; Region: Ig; cl11960" /db_xref="CDD:448366" misc_feature 3729..3743 /gene="Obscn" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 3765..3779 /gene="Obscn" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 3840..3854 /gene="Obscn" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 3882..3899 /gene="Obscn" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 3909..3920 /gene="Obscn" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" misc_feature 3963..4208 /gene="Obscn" /note="Immunoglobulin domain; Region: Ig; cl11960" /db_xref="CDD:448366" misc_feature 4005..4019 /gene="Obscn" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 4041..4055 /gene="Obscn" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 4116..4130 /gene="Obscn" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 4158..4175 /gene="Obscn" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 4185..4196 /gene="Obscn" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" misc_feature 4239..4484 /gene="Obscn" /note="Immunoglobulin domain; Region: Ig; cl11960" /db_xref="CDD:448366" misc_feature 4281..4295 /gene="Obscn" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 4317..4331 /gene="Obscn" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 4392..4406 /gene="Obscn" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 4434..4451 /gene="Obscn" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 4461..4472 /gene="Obscn" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" misc_feature 4515..4760 /gene="Obscn" /note="Immunoglobulin domain; Region: Ig; cl11960" /db_xref="CDD:448366" misc_feature 4557..4571 /gene="Obscn" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 4593..4607 /gene="Obscn" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 4668..4682 /gene="Obscn" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 4710..4727 /gene="Obscn" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 4737..4748 /gene="Obscn" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" misc_feature 4791..5036 /gene="Obscn" /note="Immunoglobulin domain; Region: Ig; cl11960" /db_xref="CDD:448366" misc_feature 4833..4847 /gene="Obscn" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 4869..4883 /gene="Obscn" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 4944..4958 /gene="Obscn" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 4986..5003 /gene="Obscn" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 5013..5024 /gene="Obscn" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" misc_feature 5067..5312 /gene="Obscn" /note="Immunoglobulin domain; Region: Ig; cl11960" /db_xref="CDD:448366" misc_feature 5109..5123 /gene="Obscn" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 5145..5159 /gene="Obscn" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 5220..5234 /gene="Obscn" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 5262..5279 /gene="Obscn" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 5289..5300 /gene="Obscn" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" misc_feature 5343..5588 /gene="Obscn" /note="Immunoglobulin domain; Region: Ig; cl11960" /db_xref="CDD:448366" misc_feature 5385..5399 /gene="Obscn" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 5421..5435 /gene="Obscn" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 5496..5510 /gene="Obscn" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 5538..5555 /gene="Obscn" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 5565..5576 /gene="Obscn" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" misc_feature 5619..5864 /gene="Obscn" /note="Immunoglobulin domain; Region: Ig; cl11960" /db_xref="CDD:448366" misc_feature 5661..5675 /gene="Obscn" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 5697..5711 /gene="Obscn" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 5772..5786 /gene="Obscn" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 5814..5831 /gene="Obscn" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 5841..5852 /gene="Obscn" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" misc_feature 5895..6140 /gene="Obscn" /note="Immunoglobulin domain; Region: Ig; cl11960" /db_xref="CDD:448366" misc_feature 5937..5951 /gene="Obscn" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 5973..5987 /gene="Obscn" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 6048..6062 /gene="Obscn" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 6090..6107 /gene="Obscn" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 6117..6128 /gene="Obscn" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" misc_feature 6192..6392 /gene="Obscn" /note="Immunoglobulin domain; Region: Ig; cl11960" /db_xref="CDD:448366" misc_feature 6219..6233 /gene="Obscn" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 6258..6272 /gene="Obscn" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 6333..6347 /gene="Obscn" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 6375..6392 /gene="Obscn" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 6450..6692 /gene="Obscn" /note="Immunoglobulin domain; Region: Ig; cl11960" /db_xref="CDD:448366" misc_feature 6489..6503 /gene="Obscn" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 6525..6539 /gene="Obscn" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 6600..6614 /gene="Obscn" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 6642..6659 /gene="Obscn" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 6669..6680 /gene="Obscn" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" misc_feature 6711..6962 /gene="Obscn" /note="Immunoglobulin domain; Region: Ig; cl11960" /db_xref="CDD:448366" misc_feature 6759..6773 /gene="Obscn" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 6795..6809 /gene="Obscn" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 6870..6884 /gene="Obscn" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 6912..6929 /gene="Obscn" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 6939..6950 /gene="Obscn" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" misc_feature 6981..7232 /gene="Obscn" /note="Immunoglobulin domain; Region: Ig; cl11960" /db_xref="CDD:448366" misc_feature 7026..7040 /gene="Obscn" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 7062..7076 /gene="Obscn" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 7137..7151 /gene="Obscn" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 7179..7196 /gene="Obscn" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 7512..7760 /gene="Obscn" /note="Immunoglobulin domain; Region: Ig; cl11960" /db_xref="CDD:448366" misc_feature 7560..7574 /gene="Obscn" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 7593..7607 /gene="Obscn" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 7668..7682 /gene="Obscn" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 7710..7727 /gene="Obscn" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 7737..7748 /gene="Obscn" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" misc_feature 7776..8027 /gene="Obscn" /note="Immunoglobulin domain; Region: Ig; cl11960" /db_xref="CDD:448366" misc_feature 7824..7838 /gene="Obscn" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 7863..7874 /gene="Obscn" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 7935..7949 /gene="Obscn" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 7977..7994 /gene="Obscn" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 8049..8294 /gene="Obscn" /note="Immunoglobulin domain; Region: Ig; cl11960" /db_xref="CDD:448366" misc_feature 8094..8105 /gene="Obscn" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 8127..8141 /gene="Obscn" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 8202..8216 /gene="Obscn" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 8244..8261 /gene="Obscn" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 8580..8831 /gene="Obscn" /note="Immunoglobulin I-set domain; Region: I-set; pfam07679" /db_xref="CDD:400151" misc_feature 8628..8642 /gene="Obscn" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 8667..8678 /gene="Obscn" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 8739..8753 /gene="Obscn" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 8781..8798 /gene="Obscn" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 8850..9098 /gene="Obscn" /note="Immunoglobulin domain; Region: Ig; cl11960" /db_xref="CDD:448366" misc_feature 8898..8909 /gene="Obscn" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 8931..8945 /gene="Obscn" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 9006..9020 /gene="Obscn" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 9075..9086 /gene="Obscn" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" misc_feature 9114..9365 /gene="Obscn" /note="Immunoglobulin domain; Region: Ig; cl11960" /db_xref="CDD:448366" misc_feature 9162..9176 /gene="Obscn" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 9198..9212 /gene="Obscn" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 9273..9287 /gene="Obscn" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 9315..9332 /gene="Obscn" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 9384..>9590 /gene="Obscn" /note="Immunoglobulin domain; Region: Ig; cl11960" /db_xref="CDD:448366" misc_feature 9429..9443 /gene="Obscn" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 9471..9485 /gene="Obscn" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 9546..9560 /gene="Obscn" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 9687..9905 /gene="Obscn" /note="Immunoglobulin domain; Region: Ig; cl11960" /db_xref="CDD:448366" misc_feature 9702..9716 /gene="Obscn" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 9738..9752 /gene="Obscn" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 9813..9827 /gene="Obscn" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 9855..9872 /gene="Obscn" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 9882..9893 /gene="Obscn" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" misc_feature 9921..10172 /gene="Obscn" /note="Immunoglobulin domain; Region: Ig; cl11960" /db_xref="CDD:448366" misc_feature 9969..9983 /gene="Obscn" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 10005..10019 /gene="Obscn" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 10080..10094 /gene="Obscn" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 10194..10445 /gene="Obscn" /note="Immunoglobulin domain; Region: Ig; cl11960" /db_xref="CDD:448366" misc_feature 10236..10250 /gene="Obscn" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 10275..10289 /gene="Obscn" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 10353..10367 /gene="Obscn" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 10422..10433 /gene="Obscn" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" misc_feature 10464..10712 /gene="Obscn" /note="Immunoglobulin I-set domain; Region: I-set; pfam07679" /db_xref="CDD:400151" misc_feature 10509..10523 /gene="Obscn" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 10545..10559 /gene="Obscn" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 10620..10634 /gene="Obscn" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 10662..10679 /gene="Obscn" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 10689..10700 /gene="Obscn" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" misc_feature 10728..10979 /gene="Obscn" /note="Immunoglobulin I-set domain; Region: I-set; pfam07679" /db_xref="CDD:400151" misc_feature 10776..10790 /gene="Obscn" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 10815..10826 /gene="Obscn" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 10890..10901 /gene="Obscn" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 10956..10967 /gene="Obscn" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" misc_feature 10995..11243 /gene="Obscn" /note="Immunoglobulin domain; Region: Ig; cl11960" /db_xref="CDD:448366" misc_feature 11043..11057 /gene="Obscn" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 11076..11090 /gene="Obscn" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 11151..11165 /gene="Obscn" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 11193..11210 /gene="Obscn" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 11220..11231 /gene="Obscn" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" misc_feature 11259..11507 /gene="Obscn" /note="Immunoglobulin domain; Region: Ig; cl11960" /db_xref="CDD:448366" misc_feature 11307..11321 /gene="Obscn" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 11340..11354 /gene="Obscn" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 11415..11429 /gene="Obscn" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 11457..11474 /gene="Obscn" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 11484..11495 /gene="Obscn" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" misc_feature 11523..11771 /gene="Obscn" /note="Immunoglobulin domain; Region: Ig; cl11960" /db_xref="CDD:448366" misc_feature 11571..11585 /gene="Obscn" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 11604..11618 /gene="Obscn" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 11679..11693 /gene="Obscn" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 11721..11738 /gene="Obscn" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 11748..11759 /gene="Obscn" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" misc_feature 11787..12035 /gene="Obscn" /note="Immunoglobulin domain; Region: Ig; cl11960" /db_xref="CDD:448366" misc_feature 11835..11849 /gene="Obscn" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 11871..11882 /gene="Obscn" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 11943..11957 /gene="Obscn" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 11985..12002 /gene="Obscn" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 12012..12023 /gene="Obscn" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" misc_feature 12051..12299 /gene="Obscn" /note="Immunoglobulin domain; Region: Ig; cl11960" /db_xref="CDD:448366" misc_feature 12099..12113 /gene="Obscn" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 12132..12146 /gene="Obscn" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 12207..12221 /gene="Obscn" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 12249..12266 /gene="Obscn" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 12276..12287 /gene="Obscn" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" misc_feature 12312..12563 /gene="Obscn" /note="Immunoglobulin domain; Region: Ig; cl11960" /db_xref="CDD:448366" misc_feature 12363..12377 /gene="Obscn" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 12396..12410 /gene="Obscn" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 12471..12485 /gene="Obscn" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 12513..12530 /gene="Obscn" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 12540..12551 /gene="Obscn" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" misc_feature 12576..12833 /gene="Obscn" /note="Immunoglobulin I-set domain; Region: I-set; pfam07679" /db_xref="CDD:400151" misc_feature 12627..12641 /gene="Obscn" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 12666..12680 /gene="Obscn" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 12741..12755 /gene="Obscn" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 12783..12797 /gene="Obscn" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 12810..12821 /gene="Obscn" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" misc_feature 12846..13097 /gene="Obscn" /note="Immunoglobulin domain; Region: Ig; cl11960" /db_xref="CDD:448366" misc_feature 12897..12911 /gene="Obscn" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 12930..12944 /gene="Obscn" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 13005..13019 /gene="Obscn" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 13047..13064 /gene="Obscn" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 13074..13085 /gene="Obscn" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" misc_feature 13110..13361 /gene="Obscn" /note="Immunoglobulin domain; Region: Ig; cl11960" /db_xref="CDD:448366" misc_feature 13161..13175 /gene="Obscn" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 13197..13208 /gene="Obscn" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 13269..13283 /gene="Obscn" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 13311..13328 /gene="Obscn" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 13338..13349 /gene="Obscn" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" misc_feature 13374..13625 /gene="Obscn" /note="Immunoglobulin domain; Region: Ig; cl11960" /db_xref="CDD:448366" misc_feature 13425..13439 /gene="Obscn" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 13458..13472 /gene="Obscn" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 13533..13547 /gene="Obscn" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 13575..13592 /gene="Obscn" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 13602..13613 /gene="Obscn" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" misc_feature 13638..13889 /gene="Obscn" /note="Immunoglobulin domain; Region: Ig; cl11960" /db_xref="CDD:448366" misc_feature 13689..13703 /gene="Obscn" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 13797..13811 /gene="Obscn" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 13839..13853 /gene="Obscn" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 13866..13877 /gene="Obscn" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" misc_feature 13902..14153 /gene="Obscn" /note="Immunoglobulin domain; Region: Ig; cl11960" /db_xref="CDD:448366" misc_feature 13953..13967 /gene="Obscn" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 13986..14000 /gene="Obscn" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 14061..14075 /gene="Obscn" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 14103..14120 /gene="Obscn" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 14130..14141 /gene="Obscn" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" misc_feature 14169..14417 /gene="Obscn" /note="Immunoglobulin domain; Region: Ig; cl11960" /db_xref="CDD:448366" misc_feature 14217..14231 /gene="Obscn" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 14253..14264 /gene="Obscn" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 14325..14339 /gene="Obscn" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 14367..14384 /gene="Obscn" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 14394..14405 /gene="Obscn" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" misc_feature 14433..14684 /gene="Obscn" /note="Immunoglobulin domain; Region: Ig; cl11960" /db_xref="CDD:448366" misc_feature 14481..14495 /gene="Obscn" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 14517..14531 /gene="Obscn" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 14592..14606 /gene="Obscn" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 14634..14651 /gene="Obscn" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 14661..14672 /gene="Obscn" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" misc_feature 14700..14951 /gene="Obscn" /note="Immunoglobulin domain; Region: Ig; cl11960" /db_xref="CDD:448366" misc_feature 14748..14762 /gene="Obscn" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 14784..14798 /gene="Obscn" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 14859..14873 /gene="Obscn" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 14901..14918 /gene="Obscn" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 14928..14939 /gene="Obscn" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" misc_feature 15000..15224 /gene="Obscn" /note="Immunoglobulin domain; Region: Ig; cl11960" /db_xref="CDD:448366" misc_feature 15015..15029 /gene="Obscn" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 15057..15071 /gene="Obscn" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 15132..15146 /gene="Obscn" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 15174..15191 /gene="Obscn" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 15201..15212 /gene="Obscn" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" misc_feature 15243..15500 /gene="Obscn" /note="Immunoglobulin domain; Region: Ig; cl11960" /db_xref="CDD:448366" misc_feature 15288..15302 /gene="Obscn" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 15327..15341 /gene="Obscn" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 15402..15422 /gene="Obscn" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 15507..15773 /gene="Obscn" /note="Immunoglobulin domain; Region: Ig; cl11960" /db_xref="CDD:448366" misc_feature 15564..15578 /gene="Obscn" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 15603..15617 /gene="Obscn" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 15681..15695 /gene="Obscn" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 15750..15761 /gene="Obscn" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" misc_feature 15795..16010 /gene="Obscn" /note="Immunoglobulin domain; Region: Ig; cl11960" /db_xref="CDD:448366" misc_feature 15837..15851 /gene="Obscn" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 15876..15890 /gene="Obscn" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 15954..15968 /gene="Obscn" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 16080..16280 /gene="Obscn" /note="Immunoglobulin like; Region: IG_like; smart00410" /db_xref="CDD:214653" misc_feature 16329..16586 /gene="Obscn" /note="Immunoglobulin domain; Region: Ig; cl11960" /db_xref="CDD:448366" misc_feature 16602..16862 /gene="Obscn" /note="Immunoglobulin domain; Region: Ig; cl11960" /db_xref="CDD:448366" misc_feature 16650..16664 /gene="Obscn" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 16692..16706 /gene="Obscn" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 16770..16784 /gene="Obscn" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 16812..16829 /gene="Obscn" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 16839..16850 /gene="Obscn" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" misc_feature 16872..17129 /gene="Obscn" /note="Fibronectin type 3 domain; One of three types of internal repeats found in the plasma protein fibronectin. Its tenth fibronectin type III repeat contains an RGD cell recognition sequence in a flexible loop between 2 strands. Approximately 2% of all...; Region: FN3; cd00063" /db_xref="CDD:238020" misc_feature order(16872..16874,17067..17069,17112..17114) /gene="Obscn" /note="Interdomain contacts [active]" /db_xref="CDD:238020" misc_feature order(17115..17120,17124..17129) /gene="Obscn" /note="Cytokine receptor motif [active]" /db_xref="CDD:238020" misc_feature 17319..17504 /gene="Obscn" /note="Immunoglobulin domain; Region: Ig; cl11960" /db_xref="CDD:448366" misc_feature 17340..17354 /gene="Obscn" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 17376..17390 /gene="Obscn" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 17451..17465 /gene="Obscn" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 18114..18386 /gene="Obscn" /note="Immunoglobulin I-set domain; Region: I-set; pfam07679" /db_xref="CDD:400151" misc_feature 18165..18179 /gene="Obscn" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 18204..18218 /gene="Obscn" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 18282..18296 /gene="Obscn" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 18324..18341 /gene="Obscn" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 18363..18374 /gene="Obscn" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" misc_feature 18804..19076 /gene="Obscn" /note="Immunoglobulin I-set domain; Region: I-set; pfam07679" /db_xref="CDD:400151" misc_feature 18855..18869 /gene="Obscn" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 18894..18908 /gene="Obscn" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 18972..18986 /gene="Obscn" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 19014..19031 /gene="Obscn" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 19053..19064 /gene="Obscn" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" misc_feature 19200..19472 /gene="Obscn" /note="Immunoglobulin I-set domain; Region: I-set; pfam07679" /db_xref="CDD:400151" misc_feature 19251..19268 /gene="Obscn" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 19293..19307 /gene="Obscn" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 19368..19382 /gene="Obscn" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 19410..19427 /gene="Obscn" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 19449..19460 /gene="Obscn" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" misc_feature 19533..19820 /gene="Obscn" /note="Immunoglobulin I-set domain; Region: I-set; pfam07679" /db_xref="CDD:400151" misc_feature 19584..19598 /gene="Obscn" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 19623..19637 /gene="Obscn" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 19716..19730 /gene="Obscn" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 19758..19775 /gene="Obscn" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 19797..19808 /gene="Obscn" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" misc_feature 20226..20414 /gene="Obscn" /note="Src homology 3 domain of Obscurin and similar proteins; Region: SH3_Obscurin_like; cd12025" /db_xref="CDD:212958" misc_feature order(20247..20249,20253..20255,20277..20282,20331..20339, 20388..20390,20394..20396,20400..20405) /gene="Obscn" /note="peptide ligand binding site [polypeptide binding]; other site" /db_xref="CDD:212958" misc_feature 20511..21041 /gene="Obscn" /note="Guanine nucleotide exchange factor for Rho/Rac/Cdc42-like GTPases; Also called Dbl-homologous (DH) domain. It appears that PH domains invariably occur C-terminal to RhoGEF/DH domains; Region: RhoGEF; cl02571" /db_xref="CDD:445839" misc_feature order(20520..20522,20532..20534,20898..20903,20910..20915, 20919..20924,20931..20936,20943..20948,20955..20957, 21033..21035) /gene="Obscn" /note="GTPase interaction site [polypeptide binding]; other site" /db_xref="CDD:238091" misc_feature 21066..21440 /gene="Obscn" /note="Obscurin pleckstrin homology (PH) domain; Region: PH_Obscurin; cd13239" /db_xref="CDD:270059" misc_feature 21462..21734 /gene="Obscn" /note="First immunoglobulin-like domains A168 within the A-band segment of human cardiac titin, and similar domains; a member of the I-set of IgSF domains; Region: IgI_1_Titin-A168_like; cd20971" /db_xref="CDD:409563" misc_feature 21477..21497 /gene="Obscn" /note="Ig strand A' [structural motif]; Region: Ig strand A'" /db_xref="CDD:409563" misc_feature 21510..21536 /gene="Obscn" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409563" misc_feature 21552..21569 /gene="Obscn" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409563" misc_feature 21576..21584 /gene="Obscn" /note="Ig strand C' [structural motif]; Region: Ig strand C'" /db_xref="CDD:409563" misc_feature 21600..21623 /gene="Obscn" /note="Ig strand D [structural motif]; Region: Ig strand D" /db_xref="CDD:409563" misc_feature 21630..21650 /gene="Obscn" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409563" misc_feature 21669..21695 /gene="Obscn" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409563" misc_feature 21702..21734 /gene="Obscn" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409563" misc_feature 21744..22013 /gene="Obscn" /note="Immunoglobulin domain; Region: Ig; cl11960" /db_xref="CDD:448366" misc_feature 21795..21809 /gene="Obscn" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 21834..21848 /gene="Obscn" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 21915..21929 /gene="Obscn" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 21957..21974 /gene="Obscn" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 21996..22007 /gene="Obscn" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" misc_feature 22506..22775 /gene="Obscn" /note="Immunoglobulin I-set domain; Region: I-set; pfam07679" /db_xref="CDD:400151" misc_feature 22557..22571 /gene="Obscn" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 22596..22610 /gene="Obscn" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 22671..22685 /gene="Obscn" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 22713..22730 /gene="Obscn" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 22752..22763 /gene="Obscn" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" misc_feature 22827..23597 /gene="Obscn" /note="Protein Kinases, catalytic domain; Region: PKc_like; cl21453" /db_xref="CDD:451246" misc_feature order(22854..22865,22872..22874,22878..22880,22917..22919, 22923..22925,23007..23009,23055..23066,23193..23195, 23205..23210,23214..23216,23250..23255) /gene="Obscn" /note="ATP binding site [chemical binding]; other site" /db_xref="CDD:270870" misc_feature 25746..25994 /gene="Obscn" /note="Immunoglobulin I-set domain; Region: I-set; pfam07679" /db_xref="CDD:400151" misc_feature 25797..25811 /gene="Obscn" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 25836..25850 /gene="Obscn" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 25911..25928 /gene="Obscn" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 25956..25973 /gene="Obscn" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 25998..26009 /gene="Obscn" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" misc_feature 26028..26264 /gene="Obscn" /note="Fibronectin type 3 domain; Region: FN3; smart00060" /db_xref="CDD:214495" misc_feature 26364..27134 /gene="Obscn" /note="Protein Kinases, catalytic domain; Region: PKc_like; cl21453" /db_xref="CDD:451246" misc_feature order(26394..26405,26412..26414,26418..26420,26457..26459, 26463..26465,26547..26549,26595..26606,26733..26735, 26745..26750,26754..26756,26784..26789) /gene="Obscn" /note="ATP binding site [chemical binding]; other site" /db_xref="CDD:270870" ORIGIN
gcctgtcctttcgtccctgtccagtctgaggaccggctggagtgtgggctgctgggtgggaaccacgtcgtcctgggccccaggaaggaggcagacccagcagccccccaactcaccatctgtgccccttgcctgggtgctgccccaacccctggtagacacagtcccccaaccctgctaacatcatggaccactccttcagcggagcaccccgcttcctgacgcggccaaaggcttttgtggtatctgttggcaaggatgccacgctgagctgccagatcgtgggcaaccccacgccacacgtgagctgggagaaggaccggcagccagtggaggcaggagcacgcttccgcctggcccaggacggggatgtgtaccgcctcaccatcctcgatctggctctaggtgacagcgggcagtacgtgtgtcgagcgaggaacgccataggggaggccttcgccgctgtaggtttgcgagtggactcggagggcacgtgtgccgagcaggcgccccactttctgctgcggcccacctccattcgtgtgcgcgagggcgcagacgccaccttccgatgtcgcgtcggcggctcaccgcaacctgctgtgagctggtccaaagatgggcggcgcctaggtgcaccagatgccccccacgtgcgcgtggaagatcgcggagaggcgagcgcgcttcgcatccggtcggcaaggcctcgcgatggtggcacctacgaagttcgagcagagaacccactgggctccgccagcgctgccgccgctctcgtggtggactcggatgccgaggctgccggaccacccggaacctccgttgccacgctcctggcgcacctgcagcagcggcgcgaggccatgcgcgcagagggcgtccctccttctccacctggtgctggcacgcgcacctgcacggtgaccgaaggcaaacacgcgcgcctcagctgctttgtgaccggcgagcccaagcccgagacagtgtggaagaaggacgggcagctggtgaacgagggccggagacacgtagtatatgaggatgagcaagagaacttcgtccttaagattcttttttgcaagcagtctgatcgcggcctctacacttgcacagcatccaacctcgtgggccagacctacagctcggtgctggtggtcgtgagagagcctgcggtgcccttcaagaagcggctgcaggacctggaggtgcgagagaaagagtctgccacattccagtgtgaggtggctcagccagccaccgaggcggcgtggttcaaggaggagacccggctatgggccagcgccaagtacgacatcgaggaggagggcaccgagcgccggctgactgtgcgcaacgtctcggcagacgacgacgcggtgtacatctgcgagaccacagagggcagccgcacggtggcagagctctcagttaaaggaaacttgaccagaaagctgcctcggaaaacagcagtgaggactggagacacagccatcttttgggtggagctggctgtccccgaaggccctgtccagtggctacggaaccaggaggagatggtggcagggggcaggattgccatcactgcagaaggcacttgccacacactgaccatcttccagtgcaccttggaggacatgggtgaggtggccttcgtggctggtggctgcagaacgactacccagttctgtgtatcagcacccaggaggccacccctgtaccctcctgctgaccctgttgtgaaggccaagacagagagttctgtgacccttagctggtccccaccaccccatggggaccgccctgtcactattgatggttatgtggtggagaagaggaagctgggtgcctatgcctggagcaggtgtcatgaagcagaatggctggccacaactgagtttactattgctggcgtggctgaggaaggggacttccagttccgagtgtcagccatcaatcactttggccacagtccttaccttgagtttccagggaccatgcacttggtccccacgctggctgtaaagacacctctgaaggcggtggaggccatggagggtggtgaggtcactttctccgtggacctcacggtggcgtcttcgggtgagtggttcctggacgggaaggccttgaaagagagcagtacatacgtgatccgttgtgaccgtacccggcacatgctcaccatcagagaggtgcctgccagcttgcacggggcacagctgaagtttgtggctaatggcattgaaaccagcatccaaatggtggtccgaggggctctggggctgcccagcaacaagcttcctgccgtggctgcccgggaggtgctggcccagctgcatgaggaggcacagctgctggctgagctgtcagaccaggctgcggctgtgacttggctaaaggatggtcgtgagctgtccctaggacccaagtatgagatgcaggtgtcggctgggaagcaagcactgctggtgcgggatgtggcacaggatgacgctgggctctatgagtgtgttagtcgtgggagccgcatcacctaccagctgttggtgcaagaggccaatttgatgtttgccaagaagcagcaggcacgcagcgaggtgaaggcagaggttggggccagtgccacactgagctgcgaggtggcccaggcccagactgaggtgacatggttcaaggacgggaagaagctgagctccagctcgaaggtgcgcatggaggcctcgggctgctccaggaggctggtggtgcagcaggtgggcaaggcagatgctggggagtacagctgtgaggccgggggacagaaggtctccttccgcctggacgtcacagagcccaaggtggtgtttgccaaggggcagcagtcacacagcaaggtgaaggcagaggcaggggccaatgccacactgagctgcgaggtggcccaggcccagactgaggtgacatggttcaaggacgggaagaagctgagctccagctccaaggtgtgtgtggaggcctcgggctgctccaggaggctggtggtgcagcaggcgggcaaggcggatgctggggagtacagctgcgaggccgggggacagaaggtctccttctgcctggacgtggcagagcccaaggtggtgtttgccaaggagcagcaggcacgcagtgaggtgaaggcagaggcaggagccagtgccacactgagctgcgaggtggcccaggcccagactgaggtgtcatggttcaaggacgggaagaagctgagctccagctcgaaggtgcgcatggaggcctcgggctgctccaggaggctggtggtgcagcaggcgggcaaggcggatgctggggagtacagctgcgaggccgggggacagaaggtctccttccgcctggacgtcacagaacccaaggtggtgtttgccaaggagcagcaggcacgcagcgaggtgaaggcagaggccggggccaatgccacactgagctgcgaggtggccgaggcccagactgaggtgtcatggttcaaggacgggaagaagctgagctccagctccaagctgcgtgtggaggcctcgggctgctccaggaggctggtggtgcagcaggcgggcaaggcagatgctggggagtacagctgtgaggccgggggacagaaggtctccttccgcctggacgtcacagaacccaaggtggtgtttgccaaggagcagcaggcacgcagcgaggtgaaggcagaggccggggccagtgccacactgagctgcgaggtggcccaggcccagactgaggtgacatggttcaaggatgggaagaagctgagctccagctccaaggtgcgcgtggaggcctcgggctgctccaggaggctggtggtgcagcaggcgggcaaggcagatgctggggagtacagctgcgaggccgggggacagaaggtctccttccgtctggatgtggcagaacccaaggtggtgtttgccaaggagcagcaggcacgcagtgaggtgaaggcagaggcgggggccagtgccacactgagctgcgaggtggcccaggcccagactgaggtgacgtggttcaaggacgggaagaagttgagctctagctccaaggtgcgcgtggaggcctcgggctgctccaggaggctggtggtgcagcaggcgggcaaggcggatgctggggagtacagctgtgaggccgggggacagaaggtctccttccgcctggacgtggcagagcccaaggtggtgtttgccaaggagcagcaggcacgcagcgaggtgaaggcagaggccggggccagtgccacactgagctgcgaggtggcccaggcccagactgaggtgacatggttcaaggacgggaagaagctgagctctagctcgaaggtgtgcgtggaggcctcgggctgctccaggaggctggtggtgcagcaggcgggcaaggcggatgctggggagtacagctgcgaggccgggggacagaaggtctccttccgtctggacgtagcagagcccaagctggtgtttgccaaggagcagcaggcacgcagcgaggtgaaggcagaggccggggccagtgccacactgagctgcgaggtggcccaggcccagactgaggtgacgtggttcaaggacgggaagaagttgagctctagctccaaggtgcgcgtggaggcctcgggctgctccaggaggctggtggtgcagcaagcgggcaaggcagatgctggagagtacagctgtgaggccgggggacagaaggtctccttccgcctggatgtgccagagcccaaggtggtgtttgccaaggagcagcaggcacgcagcgaggtgaaggcagaggccggggccagtgccacactgagctgcgaggtggcccaggcccagactgaggtgacatggttcaaggacgggaagaagctgagctccagctccaaggtgcgagtggaggcctcgggctgctccaggaggctggtggtgcagcaggcgggcaaggcggatgctggggagtacagctgcgaggccgggggacagaaggtctccttccgtctggacgtcacagagcccaagctggtatttgccaaggagcagcaggcacgcagcgaggtgaaggcagaggctggggccagtgccacactgagctgcgaggtggcccaggcccagactgaggtgacatggttcaaggatgggaagaagctgagctccagctcgaaggtgcgcgtggaggcctcaggctgctccaggaggctggtggtgcagcaggcgggcaaggcggatgctggggagtacagctgtgaggccgggggacagaaggtctccttccgcctggacgtcacagagcccaaggtggtgtttgccaaggagcagcaggcacgcagtgaggtgaaggcagaggcaggggccagtgccacactgagctgcgaggtggcccaggcccagactgaggtgtcgtggttcaaggacgggaagaagctgagctccagctcgaaggtgcgcgtggaggcctcaggctgctccaggaggctggtggtgcagcaggcgggcaaggcggatgctggggagtacagctgcgaggccgggggacagaaggtctccttccgcctggacgtggcagagcccaaggtggtgtttgccaaggagcagcaggcatgcagcgaggtgaaggcagaggcaggggccagtgccacactgagctgcgaggtggcccaggcccagactgaggtgatatggttcaaggatgggaagaagctgagctccagctcgaaggtgcgcgtggaggcctcaggctgctccaggaggctggtggtgcagcaggtgggcaaggcggatgctggggagtacagctgcgaggccgggggacagaaggtctccttccgtctggatgtgccagacaccaaacttatgtttgccaaggagcagcaggcatgcagcgaggtgaaggcagaggccggggccagtgccacactgagctgtgaggtggcccaggcccagactgaggtgacatggttcaaggatgggaagaagctgagctccagctcgaaggtgcgcgtggaggcctcgggctgctccaggaggctggtggtgcagcaggcgggcaaggcggatgctggggagtacagctgcgaggccgggggacagaaggtctccttccgcctggacgtggcagaaccagagcctgagtcccaaactccacagaggcctagccgcagggagcctctggttatcaaggaacatgagaccattgtcctgagtgccacgatagctgcaccctctgtggctgctgtgacctggctcaaagacggcgtggagatccgccgcagcaagcggcatgagaccaccagtgtgggtgatactcataccctgactgtgagaggtgcacaggttctggacagtgccatctacagctgccgtgtcggcaaggaaggtcaggacttcccggtgcaggtagaagaggtggccaccaagttctccaaacccctggagcctgtggaaggggaattgggtggcactgtgacgctggtctgtgagctgagcccggaacaggctgaggttgtgtggcgctgtgggagcacacagctgcgggcgggcaagcgcttccagatgacagctgaggggtctaggcgcacactgaccgtgtctggccttcgagaggacgacgcagaggagtatgtgtgtgagagccgggatgaccgcaccagtgcacggctcactgtcaaagttccccgagtggtcaagtttacatccggattgagtgccatggcggcagaggagggccaagaggccacctttcagtgtgtcgtgtcccccagcgatgcagcagtcatgtggtacaaggacggcacgcagctgcagcctagcgagaagtttgttatggtgcagagtggggccagccgaagcttgactatcttgggcctgaccctggaggatgctgggcatgtcactgtggaggctgagggtgcttcatcatctgctgccctccgggtccgagaggcaccagtcctcttcaaaaagaagcttgagccacagacggtggaggagaggacccctgtgaccctggaagtagagctgactcgcccctggcccgaggtgaagtggacgcggaatgctgccgtcctggtacccagcgagaacgtggaaatccacgctgagggtgcccggcaccgtctggtgctgcgaagcgtgggcttcgctgaccgtggcttctttggctgtgagacaccagatgacaagactcaggccaagctcaacgtagaaatgcggcaggtccggctggttcgaggtttgcaggaggtggaggctaaggaacagggcacagcctcgatggatgtggaattgtcccatgctgacgtggaaggcagctggactcgagatggcctgcgacttcagccggggcccaaatgccacctggccgtacaaggccctgtccacatcctcacactctcagcgctgcagccacaggacagcgggttggtggccttcagggctgagggcgtgcacacgtctgcacggctcatagtcactgagttgcccgtgagcttcaccagactgctacaggatgtggtggccactcagaaggagaaggtgaccctggagtgtgagttgtcacggcccgtcgatgtgcgctggctgaaggatggtgtggagctgcgggcaggcaaggccataggcatagtggctcagggaacctgcaggagtctcgttatctaccggtgtgagactggggaccagggcgtctatgtatgtgatgctctggatgctcagacctctgcctctctgagggtgcagggacgcagtgttcagattatgaagcccctagaggatgtggaggtgatggagaaggagggtgccacattctcctgtgaggtgtcccatgatgaggttcctggcatatggttccgagaagccactaagctacggcccagtgacaatgtgcgcatccggcaggaagggaggacatatactctcatcttccggagggtactggcagaagatgcgggggagatcaagtttgtagctgaaaatgcagaatcaagggctcacctccgagtgaaagaactgcctgtgaccctcctgcgcccactacgggacaagattgccatggaaaaacaccgtggcgtgcttgagtgccaggtgtcccgggctagtgcccaggtgcggtggttcaagggcaaagtcgagctgcagcctgggcccaagtatgaggtggtcagcgacggcctttaccgcaaactggtcatcaatgatgtgcagcccgaggacgaagatacttacacctgtgatgctggcgatgtgaagaccagtgcccagttcttcgtggaagagcaatccatcactattgtgcgggggctgaaggacatgacagttatggagcctgcccctgcctggtttgaatgtgagacctccattccttctgtgaggccacccaagtggctccttggtaagactgtgctacaggcaggggggaacgtggggctggagcaagacggtactgtgcaccgactgacacttcacaagacctgctctaccatgaccgggcctgtgcacttcaccatcggcaagtcccgctccactgcccagcttgttgtctcagacattcctgtggtattgacaaggcctctggagcccaaagcagggcgcgagctgcagtcggtcgtcctgtcctgtgacttcaggccagcccccaaggctgtgcagtggtacaaggaggatacacctctgtccccgtcagaaaagttcaagatggtgctggagggccagatggcagagctgcgtatactccggcttactccagctgatgctggggtctaccggtgccaggcgggtagtgcccagagcagtgccgaggttactgtggaagctcgggaggtgacagtgatccagccactgcaggatgtggaagccatggaggaaggccgggtctgcttctcctgtgagctatctcataaggacgaggatatcgaatggtcactcaatggtacacccctgtactcggacagcttccacgagatcagccatgagggctgtctccacacgctggtgctgaagagtgtccggcaggctgacacgggcaccgtgtgtgccacctctcccaaggtgtcagtttctgcccggctggtggttaaagcaaagccagtggtgttcctaaaagcactggatgacgtatctgcagaagagcggggcacgctgaccctgcagtgcgaggtctccgacccggaggcgcgtgtggtttggcgcaaagatggtgtggagttgggtcccagcgacaagtatgacttcctacacaaggcaggtgttcggagccttacggtccatgacatgagccacgaggatgctggactgtacacctgccaggtgggcagtaaggagacccagtccagggtcagcgtgcatgaccttcatgtgggcatcaccaagaggttaaagacggtggaggtgctggagggagagagctgcagctttgagtgtgtcctctcccatgagagtcccagtgacccagcagtgtggacagttggtgggaagatagtgcgtagttctgaccacttccaggccgtacggcagggccgcaaatacactctgacagtcaaagatgctgccctcagtgatgcaggagaggtggtcttctcagtgctgggcctcacatccaaggcctcgctcatcatcagagagaagccagtggacatcacaaagcccctggaggaccagcacactacgcctggggaagatgtgatgctaagctgcgagctctctagggcaggctcctccgtgcgctggctgaaagacgggaaggccatccggaagagtcagaagtatgacctgctcattgaaggcacacaggctgtgttggttgtccgaaaggcctcgctcaaggattctggagaatacacctgtgagacagaagcctccagaagcactgccaggctgtgtgtggaagaaaagacaaaccggttcacggaggagctggctgacctgcaggtagaagagaagggcagagctgtgttcacatgcaagacagagcaaccggcatctattgtgacctggcgcaaaggcctcctggagctgcgcgcctcagggaagcatgtccccagccaggagggtttgaccctgacgcttactatcaatgccctggagaggacagacagtgacacttacacctgtgacattggccaagcccggacccaggcccggctcctcgtccatggccagaaagtacgagtcattgaggacctagaggacaccgctgtccaggagggctcctctgccaagttttgctgccgcatctcccctgctgactacggccctgtgcactggttcctggataagacccctttgcacagcaacgagctgaacgagatcactgtccagtccggaggctaccacgtgctcaccctgcggcagctgacgctcaaggattcaggcacggtctacttcgaggcgggtgaccagcggacctcagctgccctgcgggtgactgagaagccgagcatcttctctcggccactcacagatgtcacagtcacagaaggcgaggacctgactctcgtctgtgaaaccaccaccccggatagctctgtgcgctggaccaaagatgggaagacactgaggccatctgcacgatgccagctgaaccgcgaaggctgtcaggcccagctggtcatcactggcactaccctacaggatggcgggcggtacaaatgtgaggtgggcggagcctccagcagctccattgtcagggttcacgctcggccagtgcggttcagggagtccctgaaggacatggaggtgccagagggcaaggctgccacactacgctgtgtgctgtcatccgtggctgcacctgtggagtggcgtcacggagatgatgtcctgaaatccagcaacaagtatagcctgcgccaagagggtgctgtgctggaactggtcatccgagacctgaagccccaggacagcgggcagtactcatgctcctttggggaccagacaacttcagccacactcacagtgaaaacctcgtctgcccagttcataggaaaactgagaaacaaggaggccacagaagggaccatggccacacttcggtgtgagctgaccaaagaggcccccgtggaatggaagaagggaacagagaccctgagaaatggggacaaatacagtctgaagcaggatggagctgtgtgtgaactgcagatctgtaacctgcttgtggcagacgcgggggagtacttgtgtgtatgcgggcaggagaagacttcagccacgctgactgtcaaggccgttcctgtccactttatcagaaggctcaggaacaaggaggccacagaaggggacacggtcacactgcagtgtgaactgagcaaggcggcccccgtggagtggaggaagggaacagagaccctgagagatggggacagatacagcctgaagcaggatggggccgtgtgtgagctgcagatccgcagcctggctgtagcagatgctggagagtacttgtgcatgtgtggacaggaaaagacctcagccacactgaccatcagggcccttccggctaagttcatagaaagtctgaagaatgaaggggccacagaaggaaccacagccacgctgagctgcaaactgagcaaggcggttccggtgacgtggaagagaggaacaaagaccttgcgagacggagacaaatatggcctgaggcaggacggagctgtgtgtgagctgcagatccgtggcctgaccacagccgatgctggggagtactcatgtgtgtgtgggcaggagaagacatcagctgctctgactgtcaagggcttgcctgccaagtttatagaagatctaagaagccaagaggccatggaaggggccacggcaatcttaagatgtgagctgagcaaggcggcccctgtggagtggaggaaggggtccaagatcctggaagatggggacagatacaccctgaggcaggacggggccgtgtgtgaactgcagatccgtggtctggctgtggtggatactgggacgtactcatgtgtgtgtgggcaggagaagacctcggccacactgaatattaatgccctgcctgccaagttcacagagggtctgaggaatgaagagtccatggaaggcaccatggtgactctgaggtgccagatgagcaaggtgacccctgtggagtggaggaaggggtcagagaccctgagagatgggggcagatacagcctgaggcaggatggggccgtgtgtgagctgcagatccgtggcctgattctggaagatgctggggagtactcatgcgtgtgtgggcaggagaagacgtcagccacactgagtgtcaaggccctgccccccagattcatagaagacttgagaagccaagaggccatggaaggcaccatggtgactctgaggtgccagatgaacaaggcagcccctgtggagtggaggaaggggtcagagaccctgagagatgggggcagatacagcctgaggcaggatggggccgggtgtgagctgcagatccatcgcctggctctggaagatgctggggagtactcatgcgtgtgtgggcaggagaagacgtcagccacactgagtgtcaaggccctgccccccagattcatagaagacttgagaagccaagaggctacggaaggcaccatggtgactctgaggtgccagatgaacaaggcaccttcctccactgtagagtggaggaaggggtctgagagtctgagagatgggggcagatacagcctgaggcaggatggggctgtgtgtgagctgcagatccgaggcctgactctagaagatgctggggagtactcatgcgtgtttgggcaggagagaacgtcagccacactgagtgtcaaggccctgcctcccagattcatagaagacttgggaagccaagaggccatggaaggcaccatggtgactctaagatgccagatgagcaagacagcccctgtggagtggaggaaggggtcagagaccctgagagatgggggcagatacagcctgaggcaggatggggccttgtgtgagctgcagatccatcgcctggctctggaagatgctggggagtactcatgcgtgtgtgggcaggagaagacgtcagccacactgagtgtcaaggccctgcctcccagattcatagaagacttgagaagccaaaaggccacagaaggcaccatggtgactctgaggtgccagatgagcaaggtggcccctgtggagtggaggaaggggtctgagagcctgagagatggggacagatacagcctgaggcaggatggggccatgtgtgagctgcagatctgtggcctggctgtagaagacagtggggagtactcgtgcgtgtgtgggcaggagaggacatcagccacactgactgtagatgcactgccccccaagttcacagagggtctgaaaaaggaagaggccacagaagggaacatggcgactctgaggtgccagatgagcaaggcggcccctgtggagtggaggaaggggtcagagaccctgagagatgggggcagatacagcctgaggcaggatggggccgcgtgtgagctgcagatccgtggtctggctctggaagatgctggggagtactcatgcctgtgtgggcaggagaagacgtcagccacactgagtgtcaaggccctgccccccagattcatagaagacttgagaagccaagaggccacagaagggaacatggtgactctaaggtgccagatgagcaaggtgacccctgtggagtggaggaaggggtcagagaccctgagagatgggggcagatacagcctgaggcaggatggggccgtgtgtgagctgcagatccatcgcctggctctggaagatgctggggagtactcatgcctgtgtgggcaggagaagacgtcagccacactgagtgtcaaggccctgccccccagattcacagaagacttgagaagccaaaaagccacggaaggcaccatggtgactttaaggtgccagatgagcaaggcagcccctgtggagtggaggaaggggtctgagaccctgagagatgggggcagatacagcctgaggcaggatggggccgtgtatgagctgcagatccgaggcttggctctggaagatgctggggagtactcatgtgtgtgtgggcaggagaagacctcagccacactgagtgtcaaggcccttccagccagattcatagaagatttgagaagccaagaggtcccggaaagttcaacagtcacaatgcggtgtgagctaagcaagaaggcccctgtggtgtggaggaaagggtctgagaccctgaaaaatggggccaggtacagcctgagacaggatggtgctgtgtgtgagctggagatccgtgacctgactgtggaagatgctggagagtactcatgcacatgtgggaaggagaggacctcagccacactgagcattatggctccacaggtggtgttccagaagttactggagaatctgcaagcagaagaaggctccacagccagcctgcggtgtgagctgtcagtccccaacactgctgtggtctggagcaagggcggcctggagctgcaggctgacacatgccgagagacacggcagcagggctgcgttgcagaactgctgcttagggacgtgcgccgtgaggacgcgggcgagtacagctgtacctgtggttcccagaccacaagtgccacactcatggtcacagctgctcctgtgaggttcctccaggagctacaggcccaggacgtagatgaagggaccaccgcacgcctgcgctgtgagctgagccgggaggctgcgagtgtggaatggcgcaagggctccttgcagctttttccttgtgctaagtatcagatggtgcaggagggcacaactgcagagctgctagtccatggggtggagcaggaggatgcaggggaatacacctgcgatgcaggacacatgcagagcattgccaggctctccgtccgagcccccaagcccaagttcaagaccggcctacagagcaaagagcaagaagcaggtggcacagcacggctgtgttgtcaactgagcgaagctgagtcggggactccagtacaatggctcaaagagggggtggagctgcatgtcagctccaagtacgagatgcggtgccaaggggctatgtgtgagttgctgatccacaagctggaggccaaggacactggtgaatatgcctgcgtggtgggtggccagaagaccttggcctccctcagagtcaaagagcctgaggtgaccattgtgcagggactggtggacatggaggtgcaggctgatgaggatgtggagttcacttgcaaggtgtcacaggcaggagccacagatgtgcagtggcatctccaaggtctgccactgcagagcaatgaagtgacagaggtggctgttcttggagacggctgtacccatgtgctccagttgaagggtgtgacactggatgatgctggtactgtctccttccacgtgggcagccattcatcttctgctcagctcatagtccgagtccccgaggtgaccgttctggagcccctgaaggatgtgcagctcagcgagggccaggatgcccatttccagtgccggctgtccagggcttcgggccaggaggctcgctgggctttgggaggagttcccttgcagtgcaatgagatgaatgacatcactgtggagcagggcacactctactcgctcactctgcacaaggtgaccctcgaggatgccggaaccatcactctccaagtgggctcatgctcctcagaggcccagctgaaggtcacagaggcagcactgtgcctggtacgaggcttgcagaatgtggatgtcttcgcgggggaggtggccacgttctcctgtgaggtatctcgagcaggtgggccagaggcccgctggtggctggatggcaccctgcttcagaacagccctgagagtgccatgactgtacgagagggtactgttcactccctcacgctctcgggcctgggggtggctgactcaggcaccatcaccttccgcacggggcccctggtctccacagccaagttattggtcaaagatcccacagtggaggtggtgagtgccatgcaggacctggtggtggaggagggtggctcggccgagctcctctgccagtactcgcggcccgtgcaggccatgtggaagatgaacgagcgggaggtgtgcgcggatgggcaccgtgtcatcatagagcaggactggaccgtagccaggctgaccctcaggccggccctgccctgtgacagtggcatctattcttgtgaggctgcgggcactcgagttgtggcactgctccaagtgcaagccaagaacacagtggtgcgtggcctggagaatgtggatgcactggagggcggcgaagctctgttcgagtgtcagctgtcccagccggaagtggctgcccacacctggttactagacgatgagcctgtgcacacatcagcaaacgtggaggtggtctactttgagaacggactgcgccacttgcttttgctcaaaaacctgaagccacaggacagctgccgagtgaccttcctggcaggggacgtggtcacgtctgccttcctcactgtgagaggctggcgcttggaggtcctggagcccccacaagacgcatctgtgaaagctggtacgcaggtctgcttcacttgcatactaagtgaggccctgcctgtgggcgaggctacttggtacatcaacggggctgccatccaacctgatgacgctgactggatagtcaccgcagatggcagccaccatgccctgacgctgagcaacgcccagccccagcacgcaggagaggtcacatttgcagcacgtgacgccgtggcctctgcacgcctctctgtgttggctctccctggtccccctgaagatgctgaagtagtgggtcgaagtgaccactctgtgaccctatcctgggtggctcccgtgagtgacggcggcggcggtctatgtggttatcgtgtggagatgaaggaggcatccacaggccagtggcagttgtgccatgagttggtacctggcccagagtgtgtggtggacggcctggtctctgggaagacctaccgcttccgagtggcagccgtgggtccggcaggagctggggagcctgtacatctgccccagatggtcaagatagcagagccaatggaacctaaaccagccccagccccagcccctgccctagccccaaccccagctccaatcccaaccccagccccagccccagccccagccccaaccccagccccaaccccaaccccagccccagccccagcccctgccccagccccagcaacacggcgagcagtggttggtgaagatgtgtgtctggagctggaagtggcagctgatgctggcgaggtcgtctggcacaagggaacagagcgcatccatcccagtgggcactttgaggtcctctctcagggtcagcggcagatgctggtgatcaagggctttaggaccgaagaccagggggagtaccgctgtggtcccatccagggcctgccctcctcaggagcttctactttcaatgtggtcgtgacctcgggctcggaggatgaggtccctgcacagcccagcctgcctcccgaggcagcccaggagggtgacctgcatctgctttgggaggcccttgctcggaagcgtcgcatgagccgggagcccacgctggactccatcagtgagctgcccgaggaagacagccgtgtgcagcatctgcggcaggaggcagaagaggcggctcctgacctctctgagggctactccacagccgatgagctcgcacgcacaggagaagctgacctctcacacaccagctctgatgacgagtctcgggctggcaccccttccctaattacctacctcaagaaggccgggggtcctgggatctcacccttggccagcaagcatgaggcccaggtggccacgtctgtgaagccacaaaagcagcaggagcgggttgtgcccacatgcccactgccgggagatttgaacgcagcagatttgaaggatccatccctggacaaggccgctgtgaagatccaggctgcctttaagggctacaaagtgaggaaggagatgaagcagcagggaggccccgtgttctcacggacatttggggacacagaggcacaggttggggatgcgctgcggctggagtgtgtggtgtccaccaaggctgacgtgcgggcctgctggttgaaggatggcgtagagttaacagatgggcgccattaccacatagaccagctcaaggacggtacctgctctctgctggtcactggcctgggccccactgactctggtcgctacacctgtcaggtgagcaccaagtttggaagcgtgagccacagtgcctgcgtaatggtcagtgggacagaaagtgaggctgagagctcctcaggaggtgagctggacgatgccttccgccgggcagcacgacgcctgcatcgtctcttccgaaccaagagcccagctgagctttcagaagaggagctcttcctcagtgctgacgaaggccccatggagccagaggagcctgcagactggcaaacataccgagaggatgaaaactttgtgtgcatccgttttgagtcacttgcagaggcccaccgggcagtcacctgcttccgtgacatgtttgccaccatgggcatcggggtggagatcagcctaggggagcaggggccccggggagtggagatgcgcattggcaaggtggcccccactgtcatccctgcggtgccacttgcaaagacacctggcctgcagacttcagatgctgccccagtgttcctgacggagctgcagaaccaagacgtgcaggacggataccccatgagcttcgactgcgtggtaacaggccagcctgtgcccagtgtgcgctggttcaaggacgggaagttgctagaagaggatgaccactacatgatcaacgaggaccaacaggggggtcaccagctcatcatcacagccgtggtgccggcagacatgggagtgtaccgctgcctggcggagaacagcatgggcgtctcctccaccaaggctgagcttcgtgtggaattgaccagcacagactatgacactgctgctgatgctaccgagacctcatcctacttcagcgcccagggatacctgtccagccgggagcaagaggggacggagtcagatgaggggcagcttccccaggtgctggaggaactgaaagacctccaggtggcccctggcacacgcctggccaagttccagctcaaggtgaaaggttatccagctcccaaactgtactggttcaaagatggccagcccctgaccacatctgaccacatccgcatgactgacaaaaagaccctgcacaccctggagattgtctccatcacccgagaggacagcggccagtacgcggcctacatcagcaatgctgtgggtgccgcctattcgtcagcccggctgctggtccgaggtcccagtgaaccagaagagaagccacaaccagatgttcatgagaggctggtgccaccccgaatcctggagaagttcacccccaagaaagtgaagaggggctccagcatcaccttttcagtgaaggtggaaggacacccggcccccagtgtgcattggctcaaggaggaggcagagaagggagtcctgtggattggccctgatacccctggctacacgatggccagttcttccaagcaacatagcctggtcctgctggacgtaggccgacagcaccagggcacctacacgtgcattgccaccaatgctgctggccaggcgctctgctctgccagtctgcacatctctggcttggccaaagaagaggagcaggagagagtgaaggaggctctcatttcctccttcctgcaagggacgagccaagctgtctcagcccagatgtcagaatctgcaagttttgctgatcttgtcgggcaaaggaaaggtgagtccctggtggctgaggaggcccacagtcacctgtccctttctgaggtgggcacagaagagttcctgcagaaactcacctcacagatcaccgagatggtatcagccaagatctcgcaggccaaactccaggtgcctggaggtgacagtgatgaggagtctaagacaccatctgcttctcctcggcacggccggtcacgtccttcctccagtgttcaagagtcttcctcagagtcagaggatggagactcccgtggtgagatctttgacatctacgtggtcacagctgattatctgcccctgggagctgagcaggatgccatcatcctgagagaaggccagtatgtggaggtcctggactcagcccatcccctgcgctggcttgtacgcaccaagcccaccaaatccagcccttccaggcagggctgggtgtcacctgcctacctggacaagaggctcaagctatctcctgagtgggggcccactgaggcccctgagttccctggcgaggctgtgtctgaggatgagtatagaacgaggctgagctctgtcatccaggagttgctgagttcagagcaggcttttgtgggtgagttacagttcttggagagccaccacatcaagcacctggaccgatctccccgtgtacccgcagctgtggccagccagaagacggtcatctttcgtaatgtgcaggacatcagccatttccacagcagcttcttgaaggagctgcagagctgtggcaccgacgatgatgtagccatgtgcttcatcaagaaccaggaggcctttgagaagtaccttgagttcctggtgggccgggtgcaagcggaatcagtggtcgtcagcaccccagtccaggagttctacaagaaatatgcagaagagatgctgtcagccaaggaccccacacagccacccccacctcctcttcagcactacttggagcagccagtggaacgggtgcagaaataccaggccttgctgaaggagctaatccgcaacaaggctcgcaaccggcagaactgtgcgctgctggagcaggcctacgctgtggtgtctgccctgcctcagcgtgctgagaacaagctgcacgtttctctcatggagaactacccgggaaccctggaggccctgggagaacctatccgccagggtcacttcatagtgtgggagggggctccaggagcccggatgccttggaagggccacaaccggcatgtcttcctcttccgaaaccacctggtgatctgcaagccccggagagactctcgaacggacaccttcagctacgtgttccggaacatgatgaagctgaatagcatcgacctgaatgaccaggtagagggggatgaccgtgcctttgaggtgtggcacgagcgggaagactctgtccgcaagtacctgctgcaggcgcggacagtgatcatcaaaaactcatgggtgaaggagatctgtggcatccagcagcgccttgcccagcccgtgtggcgtccccctgagtttgaagaagaactagctgactgcacagccgagctgggtgaaacagtcaagctagcatgccgagtgactggcacacctaagcctattgtcagctggtacaaagatgggaagcccgtggaggtggacccacaccacatcctcattgaagaccctgatggctcctgtaccctcatcttggacaaccttactggcatagactctggccagtacatgtgttttgcggccagtgctgctggcaatgccagcaccttggggaagattctagtacaagtgcccccacgatttgtgaacaaggtccgagccacaccctttgtggagggagaggacgcgcagatcacctgcacagtggaaggagctccgtaccctcagatcaggtggtacaaggacggtgccctgctaaccctgggcaacaggtaccggatggtgaatgagccccgcagtggtatgctggtgctggtgatccaggcagccagcaaggaggacctgggacactatgaatgtgagttggtgaaccggttgggctcaacacgttgtggcggagaattatacatgcagagtcccgcactgcgtgcctgggaccagcaccaccgggaacagcttgtggctgctgtggaagacgcctccatggaggactctgcccaccccactcaggagggagctgaccaacaagccgcttctgtcctttggaggctgctgggctcagaagccctcagcccctccccagggggtttccccaacaccagacaaagtgagccacccacatcagaagaggctgctccccagatcccaggcacaacttcaggaacacctggcaaactcccagaggcttcacggcccggcacatacaaaggcctggagcaggggatgacaacaacttctggatcccaggaacggaatgtacccattcgggtggagggcacggcctggccaggcggaggcactgggcagctgctcttggatgtgcacagccaagtcatcatggagaccacacagaggacctatgtgtgccaagctcctgacacaggtgtcacaagggccccatccatgcaggtcactatcgaggacctacaagtacaagtgggtgacatggcacagtttgatgctgtcattgaaggcaacccaccgccaacagtgacctggtacaaggacagcaaccagctggtgaacggtacccggctgaggcagcagcaaggtggaactacatattccttggtgttgatggacgtgactccacacgatgccggtgtctacacctgtgttgcccagaatgcaggtggacaggtgctgtgcaaggcagagctgctggtctatgggggggacaagtcagatgctgaaaagcaagcctatcggaggaaactgcattccttctatgaagttcaagaagagattgggaggggtgtgtttggttttgtgaaaagagttcagcataaaggaaacaagatgtcctgtgctgccaagttcatccccctgcggagcaaaactcgggcccaggcataccaggaacgagacatcttggctaccctcagccacccactggtcactgggctcctggatcaatttgagacccagaagactctcatccttatcttggaactgtgctcatccgaggagctgctggatcgcctcttcaagaaggctgtagtgaccgaagctgaggtcaaggtctatatccagcagctggtggaaggcctacactacctgcacagccatgatatcctccatctggacataaagccccccaacatcctgatggtccacccagctcgggaagacattaagatctgtgactttggctttgcccaaaagatcaccccgtcagagccacagtacagcaagtatggctcacctgaattcgtgtccccagagatcatcgagcagagtcctgtgagtgagggctcagacatctgggccatgggcgtcatctcctacctcagcctcacctgttcatccccattcgctggagagagtgaccgtgccaccctgctcaatgttttggaggggcgggtctcttggagcagtcccatggctgcccatctgagtgaggatgccaaggacttcatcaaggccacactgcaaaagacccccagggcccggcctagtgcttcccagtgccttgctcacccctggttcctgaagtccatgcctgctgaggaggcccacttcatcaacaccaaacagctcaagttccttcttgctcgcagtcgctggcagcgttccttgatgagctacaagtctatcctggtgatgcgctccatccctgagctgctccagggtcctccagacagtccatctctaggagtggcccggcacctacgaggggaagccagcggatcctctagctcatcgtcttcctcggacaatgagcttgccccatttgccagggctaagtcactgccaccttcccctgtcactcactcgccactgctgcaccctcggggctttctgcggccttcagccagcctcccggaggagacagaggccagcatgtccactgctgatgcagccatgccggcacccccccagagtgctgggcctccagcaagcccaggttgtgtgccccggcacagcgtcatcagcagcttgttctaccagcaagctggtgagggtgcagagcgtgggagcaaagcgttgggcgccaagaggcacccagctcggagacgccacctgctaaagggcgggtacattgcaagggccctgcccgggctacgagagccgctgatggagtttagtgtgttggaggaagaggctgctaatgaggagcaggcctctctgatgaccaagacaccctcctttgagaccgctctgcgactacctagttccaatgtcagagaggtcccaggccgaagccgctccctggacaacccaccaggcacagccagcccctctcctgaggcatacaaggaacaatacctgtccccaccctcctcggggttgactcatgaaaccaccgccaagggcatgggacacaaagaagggttcttgcaggagtctgtccccttttcacctaccagtggtgacctgaggcctgttaagcaagaggggtcatcccaggatagctgtagagggaaaccagcctcttcctgtcactctgaactgggttctggtccgcaggagggctgtggctctccatcatcacaattgtgtggctccttacctccacagtcatcgaagaaagagctctcaaaaccctgtggcccactcttttcagaacagcctcaggcagccccattcccagcgcaagcaagcccccttctgggttctcagaaggaacctcaggatagctatctacctgaaaagccatgtccagttccctccagttctccagggtcagcctcccaagtagatgcatccctggataccgaaggcttgtcggaagctggggacacatgtgacttcacgcctcctctccagcggcctcaggagcaggccaccacccggaagttctctctggaatcccgtgggggctatgcaggggtggcaggatatggcaccttcgcctttggtggggatgcaggggggatgttagggcagggtcccctttgggccaggatggcctgggctgtgtcccagtcctcagaagagcaagatgaagcagcgactgagagccctcaacctctggacagctcagggcccattgctgaggccagtggggttcccctaaggacctcgccaagcctcaccccatgggaggaagttgagcaggtttccctggtacagatccgggatctgtctggtgatgcagaagcagccgacaccatctccttggacatttcagaggtagatcctgcctacctcaacctctccgatctatatgacatcaagtatctcccgtttgagttcatgatcttcaggagggtccccaaacctgtagagcagccagagtcacctggctctgaaactgaagaggggcaagggctggcggagttcctggaggaggctgtgtggccctggccaggcgagctgggactgcgtgctggtctggagattacagaggagccacaggagccaggggacctggaagcactgctgggcgaggctgctgtgggcaggaagcgcaagtggtccccctcccgtggcctcttccaattccctgggaggtgcctgtcaggggaggagcccgtggagcttgggctgcgccagagggtgaaggcttccatggctcacatctccaggatcctgaagggcaagccggaaggtcctgagaaggaagggcctcccagaaagaaggcaggcctagcttctttccggctatcaggcctgaagggcagggaccaagcgccatccttcctaagagaactctctgatgaggctgtggtcctgggccaatcagtgacactggcctgccaggtgttggcccagccaactgcccaggctacctggagcaaagatggggcccttctggagagcagcggccacctcctcatctcttccaccctgaagaacttccagctgctgaccattctggtggtgacggaggaggatctgggcacatatacctgctgtgtgagcaacccactagggacagcagtcaccacaggtgtcctccggaaagcagagcgcccttcatcttctccacgcccggaggtgggggaactatacacggatgcagtgttgctggtctggaagcctgtggaatcctatggcccagtgacctacattgtgcagtgctgtatagaaggaggcagctggacaaccctggcctctgacatctccgactgctgctacctcactggcaagctgccccggggtggcatgtataccttccggacagcatgtgtcagcaaagcaggaatgggcccctacagtagcccctcagaacaggtcctccttggaggacccaaccacctggcttctgaggaggaaagcagccgggggagaccagcccagcttcttcccagcacaaagacttttgccttccagacacagatccggaggggccgcttcagtgtggtgaggcagtgtagggagaaagcaagtgggcgggccctggctgctaagatcgttccctaccagcctgaggacaagacaactgtactaagagaatatgaggcactaaagagactgcaccacccacatctggcccaactccatgctgcctacctcagtccccggcacctggtgctcatcctagagctgtgctctggccctgagctgctaccctctctggcggagagggactcgtactcagagtctgatgtgaaggactacctgtggcagatgctcagtgccacccagtacctgcatgcccaacacatcctgcacctggacctgaggtcggagaacatgatggtcaccgagtacaacctgcttaaggttatagacctgggtaacgcccagagtctcagccaagagaaggtcccacctcctgaaaacttcaaagactacctagagaccatggctccagaacttctggaaggccaaggggcggttccacagacagacatctgggctattggtgtaacagccttcattatgctgagtggcgagtacccagtgagcagcgaggggactcgcgacctgcagaaaggcctgcgcaagggactcattcaattgagtcgctgctatgcaggattatcagggggtgcggtagccttcctgcagagttcattgtgcgctcggccctggggtcgcccgtgcgcttccacctgcttgcagtgcgggtggctgacggaggagggccccaccggttcccggcccacgcccgtgaccttccccaccgcgcgattgcgtgcctttgtgcgcgagcgcgagaagcgccgggcgctactctacaagaagcacaacctggctcaggtgcgctgaggcccagccctacagagcaagatgtgcccgccaataaaagatgcaaaacagcca
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]