GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2024-05-20 07:48:32, GGRNA.v2 : RefSeq release 222 (Jan, 2024)

LOCUS       NR_173353                590 bp    RNA     linear   ROD 07-OCT-2023
DEFINITION  Rattus norvegicus reproductive homeobox like (Rhoxl), non-coding
            RNA.
ACCESSION   NR_173353 XM_017602127
VERSION     NR_173353.1
KEYWORDS    RefSeq.
SOURCE      Rattus norvegicus (Norway rat)
  ORGANISM  Rattus norvegicus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha;
            Muroidea; Muridae; Murinae; Rattus.
REFERENCE   1  (bases 1 to 590)
  AUTHORS   Gaudet P, Livstone MS, Lewis SE and Thomas PD.
  TITLE     Phylogenetic-based propagation of functional annotations within the
            Gene Ontology consortium
  JOURNAL   Brief Bioinform 12 (5), 449-462 (2011)
   PUBMED   21873635
COMMENT     VALIDATED REFSEQ: This record has undergone validation or
            preliminary review. The reference sequence was derived from
            JACYVU010000455.1.
            
            On Oct 25, 2021 this sequence version replaced XM_017602127.2.
            
            ##Evidence-Data-START##
            Transcript exon combination :: FQ221578.1, BF282295.1 [ECO:0000332]
            RNAseq introns              :: single sample supports all introns
                                           SAMEA5760383, SAMEA5760389
                                           [ECO:0000348]
            ##Evidence-Data-END##
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-203               JACYVU010000455.1  1400878-1401080     c
            204-402             JACYVU010000455.1  1400097-1400295     c
            403-590             JACYVU010000455.1  1399649-1399836     c
FEATURES             Location/Qualifiers
     source          1..590
                     /organism="Rattus norvegicus"
                     /mol_type="transcribed RNA"
                     /strain="BN"
                     /db_xref="taxon:10116"
                     /chromosome="X"
                     /map="Xq35"
     gene            1..590
                     /gene="Rhoxl"
                     /gene_synonym="RGD1560927"
                     /note="reproductive homeobox like"
                     /db_xref="GeneID:501507"
                     /db_xref="RGD:1560927"
     misc_RNA        1..590
                     /gene="Rhoxl"
                     /gene_synonym="RGD1560927"
                     /product="reproductive homeobox like"
                     /db_xref="GeneID:501507"
                     /db_xref="RGD:1560927"
     exon            1..203
                     /gene="Rhoxl"
                     /gene_synonym="RGD1560927"
                     /inference="alignment:Splign:2.1.0"
     exon            204..402
                     /gene="Rhoxl"
                     /gene_synonym="RGD1560927"
                     /inference="alignment:Splign:2.1.0"
     exon            403..590
                     /gene="Rhoxl"
                     /gene_synonym="RGD1560927"
                     /inference="alignment:Splign:2.1.0"
ORIGIN      
ctcaaagcttggagcaaaacagttggcggcagcgcagcgcgaggacagtccagtcgccatctcgcagagcagaccgcctgagagagttccaagcgcctaaagtttcaagaagaccttcgaaatggatcaagcccgcaagttcgagaaccaggacacccgctatcagagcctgggaactgatgcttccttggaaggagctaaaggaatgcccggagccaagaatgatgcgggaatcaaaggccacggtgaccagaaccagccagccctgcaagctgcaggcaggatccagcatttgccgggtgattctgatatcagcatgatctgcaatgccttcagcgggctgcagcttcaagagctggatcgagtcttccaacgcactcagttccccaacgtgtttatgagaaaggaacctggagtaccagcaactgctgaatcccaagctcagtccgttgagcgcagtggaccagaagaaatgtccaagaagccattctaaaacatgcaagaagacatttcacttttccccttgttatttggctactggcccaatgtttgtgaaatttaataaaatttttgaggaattggaaatctaa
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]