GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2024-05-20 10:54:35, GGRNA.v2 : RefSeq release 222 (Jan, 2024)

LOCUS       NM_138837               3127 bp    mRNA    linear   ROD 22-NOV-2023
DEFINITION  Rattus norvegicus POU class 3 homeobox 3 (Pou3f3), mRNA.
ACCESSION   NM_138837
VERSION     NM_138837.2
KEYWORDS    RefSeq; RefSeq Select.
SOURCE      Rattus norvegicus (Norway rat)
  ORGANISM  Rattus norvegicus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha;
            Muroidea; Muridae; Murinae; Rattus.
REFERENCE   1  (bases 1 to 3127)
  AUTHORS   Snijders Blok L, Kleefstra T, Venselaar H, Maas S, Kroes HY,
            Lachmeijer AMA, van Gassen KLI, Firth HV, Tomkins S, Bodek S, Ounap
            K, Wojcik MH, Cunniff C, Bergstrom K, Powis Z, Tang S, Shinde DN,
            Au C, Iglesias AD, Izumi K, Leonard J, Abou Tayoun A, Baker SW,
            Tartaglia M, Niceta M, Dentici ML, Okamoto N, Miyake N, Matsumoto
            N, Vitobello A, Faivre L, Philippe C, Gilissen C, Wiel L, Pfundt R,
            Deriziotis P, Brunner HG and Fisher SE.
  CONSRTM   DDD Study
  TITLE     De Novo Variants Disturbing the Transactivation Capacity of POU3F3
            Cause a Characteristic Neurodevelopmental Disorder
  JOURNAL   Am J Hum Genet 105 (2), 403-412 (2019)
   PUBMED   31303265
REFERENCE   2  (bases 1 to 3127)
  AUTHORS   Mutai H, Nagashima R, Sugitani Y, Noda T, Fujii M and Matsunaga T.
  TITLE     Expression of Pou3f3/Brn-1 and its genomic methylation in
            developing auditory epithelium
  JOURNAL   Dev Neurobiol 69 (14), 913-930 (2009)
   PUBMED   19743445
  REMARK    GeneRIF: Pou3f3 may be important for the maintenance or functional
            development of the postnatal cochlea. This is the first report to
            study involvement of an epigenetic regulatory mechanism in the
            developing mammalian auditory epithelium.
REFERENCE   3  (bases 1 to 3127)
  AUTHORS   Kim DK, Han SB, Hong ST, Choi YJ, Sun W, Geum D and Kim H.
  TITLE     Expression of Sox11 and Brn transcription factors during
            development and following transient forebrain ischemia in the rat
  JOURNAL   Neurosci Lett 433 (3), 259-264 (2008)
   PUBMED   18261853
  REMARK    GeneRIF: Collectively, overall results suggest that the expression
            of Sox11 and Brn1 may be modulated by the cell-type specific
            machinery.
REFERENCE   4  (bases 1 to 3127)
  AUTHORS   Aigner B, Rathkolb B, Herbach N, Kemter E, Schessl C, Klaften M,
            Klempt M, de Angelis MH, Wanke R and Wolf E.
  TITLE     Screening for increased plasma urea levels in a large-scale ENU
            mouse mutagenesis project reveals kidney disease models
  JOURNAL   Am J Physiol Renal Physiol 292 (5), F1560-F1567 (2007)
   PUBMED   17264314
REFERENCE   5  (bases 1 to 3127)
  AUTHORS   Castro DS, Skowronska-Krawczyk D, Armant O, Donaldson IJ, Parras C,
            Hunt C, Critchley JA, Nguyen L, Gossler A, Gottgens B, Matter JM
            and Guillemot F.
  TITLE     Proneural bHLH and Brn proteins coregulate a neurogenic program
            through cooperative binding to a conserved DNA motif
  JOURNAL   Dev Cell 11 (6), 831-844 (2006)
   PUBMED   17141158
REFERENCE   6  (bases 1 to 3127)
  AUTHORS   Kuhlbrodt K, Herbarth B, Sock E, Enderich J, Hermans-Borgmeyer I
            and Wegner M.
  TITLE     Cooperative function of POU proteins and SOX proteins in glial
            cells
  JOURNAL   J Biol Chem 273 (26), 16050-16057 (1998)
   PUBMED   9632656
REFERENCE   7  (bases 1 to 3127)
  AUTHORS   Schreiber J, Enderich J, Sock E, Schmidt C, Richter-Landsberg C and
            Wegner M.
  TITLE     Redundancy of class III POU proteins in the oligodendrocyte lineage
  JOURNAL   J Biol Chem 272 (51), 32286-32293 (1997)
   PUBMED   9405434
REFERENCE   8  (bases 1 to 3127)
  AUTHORS   Malik KF, Jaffe H, Brady J and Young WS 3rd.
  TITLE     The class III POU factor Brn-4 interacts with other class III POU
            factors and the heterogeneous nuclear ribonucleoprotein U
  JOURNAL   Brain Res Mol Brain Res 45 (1), 99-107 (1997)
   PUBMED   9105675
REFERENCE   9  (bases 1 to 3127)
  AUTHORS   Sock E, Enderich J, Rosenfeld MG and Wegner M.
  TITLE     Identification of the nuclear localization signal of the POU domain
            protein Tst-1/Oct6
  JOURNAL   J Biol Chem 271 (29), 17512-17518 (1996)
   PUBMED   8663425
REFERENCE   10 (bases 1 to 3127)
  AUTHORS   Le Moine C and Young WS 3rd.
  TITLE     RHS2, a POU domain-containing gene, and its expression in
            developing and adult rat
  JOURNAL   Proc Natl Acad Sci U S A 89 (8), 3285-3289 (1992)
   PUBMED   1348858
COMMENT     VALIDATED REFSEQ: This record has undergone validation or
            preliminary review. The reference sequence was derived from
            JACYVU010000214.1.
            
            On Mar 18, 2021 this sequence version replaced NM_138837.1.
            
            Publication Note:  This RefSeq record includes a subset of the
            publications that are available for this gene. Please see the Gene
            record to access additional publications.
            
            ##RefSeq-Attributes-START##
            RefSeq Select criteria :: based on single protein-coding transcript
            ##RefSeq-Attributes-END##
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-3127              JACYVU010000214.1  940763-943889
FEATURES             Location/Qualifiers
     source          1..3127
                     /organism="Rattus norvegicus"
                     /mol_type="mRNA"
                     /strain="BN"
                     /db_xref="taxon:10116"
                     /chromosome="9"
                     /map="9q22"
     gene            1..3127
                     /gene="Pou3f3"
                     /gene_synonym="Brn1; RHS1"
                     /note="POU class 3 homeobox 3"
                     /db_xref="GeneID:192109"
                     /db_xref="RGD:619768"
     exon            1..3127
                     /gene="Pou3f3"
                     /gene_synonym="Brn1; RHS1"
                     /inference="alignment:Splign:2.1.0"
     CDS             67..1560
                     /gene="Pou3f3"
                     /gene_synonym="Brn1; RHS1"
                     /function="transcription factor"
                     /note="class III POU protein POU-domain; brain-1; brn-1
                     protein; brain-specific homeobox/POU domain protein 1"
                     /codon_start=1
                     /product="POU domain, class 3, transcription factor 3"
                     /protein_id="NP_620192.2"
                     /db_xref="GeneID:192109"
                     /db_xref="RGD:619768"
                     /translation="
MATAASNPYLPGNSLLAAGSIVHSDAAGAGGGGGGGGGGGGGAGGGGGGMQPGSAAVTSGAYRGDPSSVKMVQSDFMQGAMAASNGGHMLSHAHQWVTALPHAAAAAAAAAAAAVEASSPWSGSAVGMAGSPQQPPQPPPPPPQGPDVKGGAGREDLHAGTALHHRGPPHLGPPPPPPHQGHPGGWGAAAAAAAAAAAAAAAAHLPSMAGGQQPPPQSLLYSQPGGFTVNGMLSAPPGPGGGGGGAGGGAQSLVHPGLVRGDTPELAEHHHHHHHHAHPHPPHPHHAQGPPHHGGGGAGPGLNSHDPHSDEDTPTSDDLEQFAKQFKQRRIKLGFTQADVGLALGTLYGNVFSQTTICRFEALQLSFKNMCKLKPLLNKWLEEADSSTGSPTSIDKIAAQGRKRKKRTSIEVSVKGALESHFLKCPKPSAQEITNLADSLQLEKEVVRVWFCNRRQKEKRMTPPGIQQQTPDDVYSQVGTVSADTPPPHHGLQTSVQ"
     misc_feature    157..252
                     /gene="Pou3f3"
                     /gene_synonym="Brn1; RHS1"
                     /note="propagated from UniProtKB/Swiss-Prot (Q63262.2);
                     Region: Disordered. /evidence=ECO:0000256|SAM:MobiDB-lite"
     misc_feature    427..633
                     /gene="Pou3f3"
                     /gene_synonym="Brn1; RHS1"
                     /note="propagated from UniProtKB/Swiss-Prot (Q63262.2);
                     Region: Disordered. /evidence=ECO:0000256|SAM:MobiDB-lite"
     misc_feature    754..1014
                     /gene="Pou3f3"
                     /gene_synonym="Brn1; RHS1"
                     /note="propagated from UniProtKB/Swiss-Prot (Q63262.2);
                     Region: Disordered. /evidence=ECO:0000256|SAM:MobiDB-lite"
     misc_feature    997..1221
                     /gene="Pou3f3"
                     /gene_synonym="Brn1; RHS1"
                     /note="Found in Pit-Oct-Unc transcription factors; Region:
                     POU; smart00352"
                     /db_xref="CDD:197673"
     misc_feature    order(1276..1290,1294..1296,1345..1347,1363..1365,
                     1402..1404,1408..1413,1420..1425,1429..1437,1441..1446)
                     /gene="Pou3f3"
                     /gene_synonym="Brn1; RHS1"
                     /note="DNA binding site [nucleotide binding]"
                     /db_xref="CDD:238039"
     misc_feature    1282..1443
                     /gene="Pou3f3"
                     /gene_synonym="Brn1; RHS1"
                     /note="Homeobox domain; Region: Homeobox; pfam00046"
                     /db_xref="CDD:425441"
     misc_feature    order(1282..1284,1291..1293,1411..1413,1420..1425,
                     1432..1434)
                     /gene="Pou3f3"
                     /gene_synonym="Brn1; RHS1"
                     /note="specific DNA base contacts [nucleotide binding];
                     other site"
                     /db_xref="CDD:238039"
     misc_feature    1438..1557
                     /gene="Pou3f3"
                     /gene_synonym="Brn1; RHS1"
                     /note="propagated from UniProtKB/Swiss-Prot (Q63262.2);
                     Region: Disordered. /evidence=ECO:0000256|SAM:MobiDB-lite"
ORIGIN      
gcggccgcggctgctgctgcggcggcggcggtggtggcggcggtggggtggcgggagcggagcggcatggccacggcggcttctaacccctacctgccggggaacagcctgctcgcggccggatccattgtgcactcggacgcggccggggcgggcggcggcggagggggcggcggcggtggcggcggcggggcggggggcggcggcggcggcatgcagccgggaagcgccgccgtgacctcgggcgcctaccggggggatccgtcctccgtcaagatggtccagagtgacttcatgcagggggccatggccgccagcaacggcggccatatgctgagccacgcgcaccagtgggtcaccgccctgccccacgctgccgccgctgccgccgctgctgccgccgccgccgtggaagccagctctccgtggtcgggcagcgcggtgggcatggccggcagcccccagcagccaccacagccgccgccgccgccgccgcagggccccgacgtgaagggaggcgctggacgcgaagacctgcacgccggcacagcgctgcaccaccgcggaccgccgcacctcgggcccccgccaccgccccctcaccagggacaccctggaggctggggggccgcagccgccgctgccgctgccgccgccgccgccgctgccgccgctcacctcccgtccatggcgggcggccagcagccgccgccgcagagtctgctgtactcgcagcccggaggcttcacggtgaacggcatgctgagcgcgcccccggggccaggcggtggcggcggcggagcgggcggtggagcccaaagcctggttcacccggggttagtgcgcggggacacgcccgagctggcggagcatcatcaccaccatcaccaccacgcgcacccgcacccgccgcacccgcaccacgcgcagggacccccacatcacggtggcggcggagcggggccaggactcaacagccacgacccgcactcggacgaggacacgccgacgtctgacgacctggagcagttcgctaagcagttcaagcagcggcgcatcaagctgggcttcacccaggcggacgtggggctggctctgggcactctgtatggcaatgtgttctcgcagaccaccatctgccgcttcgaggccctgcagctcagtttcaagaacatgtgcaagctcaagccgctgctgaacaagtggctggaggaggccgactcgagcaccggcagccccaccagcattgacaagatcgcagcacagggccgcaagcgcaagaagcggacctccatcgaggttagcgtcaaaggcgcgctggagagccacttcctcaagtgccctaaaccctcggcgcaggagatcaccaacttggccgacagcctgcagctggaaaaggaggtcgtgcgggtctggttctgcaaccgacgccaaaaggaaaaacgcatgacgccccctggcatccagcagcagacgccggacgatgtctactcgcaggtggggaccgtgagcgctgacacaccgccaccgcaccacgggctgcagaccagcgtgcagtgaatgccggggcgcagcgcgaagtgggccgccgccaccacctccgcagccgctgtcagcaccgccacggtcaccgccgctgccgtctctgagcggccgccgagaaccaccgccgccgctgctgccgctgctgccgccgccgccgccgccgccgccgccgccgctgccgccgcgcagacccaacacctggccagtgccagggtgaccaggcctcctcccctccgcccaaagacaggcgagccatggccctaggaggggggagaacagctggagaccgatgagactctttctgaagtccaaggaaggagggaccaaaaacaaatttttaagcataataaataccaagactgttttatatgcatatataacaaacaaaaccggaagaggaaaagggaggaacaaggacatctcgtttatactgtggtggtgttttgttcctgttttgaaagaagggtgaagatgcctaacgcaccaaaactacacacgaggtactgtccacaccgagatgtcctgctcggcgacagtggagaacacctgcctctgagataagagagaccccctccccgttcttccacttcttccaaaagggctgcctaaaagatccatggaaactttctttactgggagcgacctgaaaagaaagacgcaccaggtttcctgcaggtctgactctgctcctcgacagtgtttttcttggccatattcaagtctttggggaacaaataaatcaactaagaaatgggaaggaaggagaaacagagtctggggggggagggaagattcacagcttctgaagttaacagactgaacaggaaagccaaaagaaagcatccttgccgtaaacttgggaataaaagcatcgcgaaagagccaaggctgggcgaggctgaagggtaggtatgtccagccgcaatccgccagcggagagggcacaacagcggggccagggcccagcctttgagaccgcccagaagggccaggtctcccccacgccactgaacccgggctttgccgactgccgctcggggtggaccatgcctaaagattccgccgctaatattttttttattaacattttttattttttatttctggactgactccgataaaagggtgtggaaagacagcaccaaccgcgcacttcccttgacttctgccctcgatccgttgccaactttgattgaatgggtgctgcggatgtgattatgtaatactgccatttccaagcagtgtttttggtaggttttaataaacagacttttcaaatgacggcaatatagaatcgttagatccgttgttgatctaaaaatatttgctttatattttcattaaatgacttcttttaatattttattcaaaatacttatgaactgctgcaaaacggtaatttatttttccccagatcttgtattacgtgtttttttcagacgagcacaaatcaaaatgaaatgaaaatatggacagttgttaggtaataagggtatcttttgatgtgatcatttgattgtaatttaatttgagtagtgattccgtaagagctgattgagaaaataaatttgttagaatgaaa
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]