2024-05-20 08:43:45, GGRNA.v2 : RefSeq release 222 (Jan, 2024)
LOCUS NM_001108363 1522 bp mRNA linear ROD 23-MAR-2023 DEFINITION Rattus norvegicus H6 family homeobox 1 (Hmx1), mRNA. ACCESSION NM_001108363 XM_001064149 XM_341238 VERSION NM_001108363.2 KEYWORDS RefSeq; RefSeq Select. SOURCE Rattus norvegicus (Norway rat) ORGANISM Rattus norvegicus Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha; Muroidea; Muridae; Murinae; Rattus. REFERENCE 1 (bases 1 to 1522) AUTHORS Quina LA, Kuramoto T, Luquetti DV, Cox TC, Serikawa T and Turner EE. TITLE Deletion of a conserved regulatory element required for Hmx1 expression in craniofacial mesenchyme in the dumbo rat: a newly identified cause of congenital ear malformation JOURNAL Dis Model Mech 5 (6), 812-822 (2012) PUBMED 22736458 REMARK GeneRIF: Dysregulation of Hmx1 expression is a candidate mechanism for congenital ear malformation. REFERENCE 2 (bases 1 to 1522) AUTHORS Amendt BA, Sutherland LB and Russo AF. TITLE Transcriptional antagonism between Hmx1 and Nkx2.5 for a shared DNA-binding site JOURNAL J Biol Chem 274 (17), 11635-11642 (1999) PUBMED 10206974 REFERENCE 3 (bases 1 to 1522) AUTHORS Yoshiura K, Leysens NJ, Reiter RS and Murray JC. TITLE Cloning, characterization, and mapping of the mouse homeobox gene Hmx1 JOURNAL Genomics 50 (1), 61-68 (1998) PUBMED 9628823 COMMENT VALIDATED REFSEQ: This record has undergone validation or preliminary review. The reference sequence was derived from JACYVU010000254.1. On Mar 18, 2021 this sequence version replaced NM_001108363.1. Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments. ##Evidence-Data-START## Transcript exon combination :: CB577861.1 [ECO:0000332] RNAseq introns :: single sample supports all introns SAMD00132287, SAMD00132291 [ECO:0000348] ##Evidence-Data-END## ##RefSeq-Attributes-START## RefSeq Select criteria :: based on conservation, expression, longest protein ##RefSeq-Attributes-END## PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP 1-379 JACYVU010000254.1 29065953-29066331 c 380-1522 JACYVU010000254.1 29062545-29063687 c FEATURES Location/Qualifiers source 1..1522 /organism="Rattus norvegicus" /mol_type="mRNA" /strain="BN" /db_xref="taxon:10116" /chromosome="14" /map="14q21" gene 1..1522 /gene="Hmx1" /note="H6 family homeobox 1" /db_xref="GeneID:360960" /db_xref="RGD:1304928" exon 1..379 /gene="Hmx1" /inference="alignment:Splign:2.1.0" CDS 4..1005 /gene="Hmx1" /note="H6 homeo box 1" /codon_start=1 /product="homeobox protein HMX1" /protein_id="NP_001101833.2" /db_xref="GeneID:360960" /db_xref="RGD:1304928" /translation="
MPDELTEPGRATPARASSFLIENLLAAEAKGSGRAAQGDGVREEEEEDDDDPEDEDPEQARRRRLQRRRQQRAGSGPGGEARARALGLGPRPPPGPGPPFALGCGGATRWYPRAQGGYGGGLSPDTSDRDSPETGEDMGRAESAWPRCPGPGAVPREVTTQGPAAGGEEAAELAEAPAVAAAAAGEARGGRRKKTRTVFSRSQVFQLESTFDLKRYLSSAERAGLAASLQLTETQVKIWFQNRRNKWKRQLAAELEAASLSPPGAQRLVRVPVLYHESPPAATGPTLPFPLAPPAPAPPPPLLGFSGALAYPLAAFPAAASVPFLRAQMPGLV"
misc_feature order(580..594,598..600,649..651,667..669,706..708, 712..717,724..729,733..741,745..750) /gene="Hmx1" /note="DNA binding site [nucleotide binding]" /db_xref="CDD:238039" misc_feature 586..747 /gene="Hmx1" /note="Homeobox domain; Region: Homeobox; pfam00046" /db_xref="CDD:425441" misc_feature order(586..588,595..597,715..717,724..729,736..738) /gene="Hmx1" /note="specific DNA base contacts [nucleotide binding]; other site" /db_xref="CDD:238039" exon 380..1522 /gene="Hmx1" /inference="alignment:Splign:2.1.0" ORIGIN
gcgatgccggatgagctgaccgagcccgggcgtgccacgccggctcgcgcctcctccttcctcatagagaacctgctggcagccgaggccaagggctcggggcgcgcagcccagggcgatggcgtccgcgaggaagaggaggaagacgacgacgaccctgaggacgaggatccggagcaggcccgacgacgacgactacagcggcggcgacagcagcgcgcaggcagcgggccgggcggagaggcgagggcccgagcgctgggcctagggccccggccgcctcccgggcccgggccgcccttcgctctcggctgcggaggcgcgacgcggtggtacccacgggcgcagggcggctacggaggtggtctgagtcctgacacaagcgaccgggactctccggagaccggcgaggatatgggccgcgcagagagcgcctggccgcggtgcccggggccgggagccgttccgcgggaggtgacgacgcagggcccggctgccggcggggaggaagcggcggagttggccgaggctccggcggtggcagccgctgcggcaggggaggcacgcggcggtcgcaggaagaagacgcgcacggtcttctcgcgcagccaggtcttccagctcgagtccactttcgatctgaaacgctacctgagcagcgcggagcgcgcaggcctcgccgcctcgctgcaactcacggagacgcaggtcaagatctggtttcagaaccgccgcaacaagtggaagcggcagctggcggccgagctggaggcggctagcctgtccccgcccggcgcgcagcgcctggtccgcgtgccggtgctctaccacgagagtcccccggccgccacggggcccacgctgcccttcccgctggctccgcctgcacccgcgccgccgccgccgctgctcggtttctcgggcgcgcttgcctacccgctggccgccttccccgccgccgcctcggtgcccttccttcgcgcgcagatgccggggctagtgtgagccggcgccctccatgcaggggcgccgggaggaggcggtgagaggaaggcgccatgcgcctcacgcagttcctcgggcgaccgtctccgtgggcagctgctccagagtgtacccagtgtaccgagtgtactgagtgtaccggacggcggcagcggggactctcagctagctgcaggactgaagacccgttccaatagaaagcggtggccggcaccgagtgctgagcagctgcgggctccgcagcagcaaacggacacttggagtgggctggccaagggaccgcatggcgactatccctgaggcaatcttgcccctaactcagaatgtccttttctcaggagggacctcgcaggaacccttccaagggacaatacagagagccgcggggggccttgggacaactgatcttgggtttcactcttgggtggccttggttctcttggcttgatgaagacttttttttttctgtgatgaatctacttctttgcatatggaataaaaagggacgttttctgga
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]