2024-05-17 20:50:30, GGRNA.v2 : RefSeq release 222 (Jan, 2024)
LOCUS XM_046927272 2021 bp mRNA linear VRT 01-MAR-2022 DEFINITION PREDICTED: Gallus gallus eukaryotic translation initiation factor 2 alpha kinase 1 (EIF2AK1), transcript variant X1, mRNA. ACCESSION XM_046927272 VERSION XM_046927272.1 DBLINK BioProject: PRJNA698614 KEYWORDS RefSeq. SOURCE Gallus gallus (chicken) ORGANISM Gallus gallus Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Archelosauria; Archosauria; Dinosauria; Saurischia; Theropoda; Coelurosauria; Aves; Neognathae; Galloanserae; Galliformes; Phasianidae; Phasianinae; Gallus. COMMENT MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NC_052586.1) annotated using gene prediction method: Gnomon, supported by mRNA and EST evidence. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Name :: Gallus gallus Annotation Release 106 Annotation Version :: 106 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 9.0 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END## FEATURES Location/Qualifiers source 1..2021 /organism="Gallus gallus" /mol_type="mRNA" /isolate="bGalGal1" /db_xref="taxon:9031" /chromosome="14" /sex="female" /tissue_type="blood" /country="USA: Fayetteville" /lat_lon="36.0822 N 94.1719 W" /collection_date="20-May-2019" /collected_by="Nick Anthony" gene 1..2021 /gene="EIF2AK1" /note="eukaryotic translation initiation factor 2 alpha kinase 1; Derived by automated computational analysis using gene prediction method: Gnomon. Supporting evidence includes similarity to: 1 mRNA, 10 ESTs, 169 long SRA reads, and 100% coverage of the annotated genomic feature by RNAseq alignments, including 79 samples with support for all annotated introns" /db_xref="CGNC:2470" /db_xref="GeneID:395360" misc_feature 1 /gene="EIF2AK1" /experiment="COORDINATES: cap analysis [ECO:0007248]" /note="transcription start site" CDS 57..1946 /gene="EIF2AK1" /codon_start=1 /product="eukaryotic translation initiation factor 2-alpha kinase 1 isoform X1" /protein_id="XP_046783228.1" /db_xref="GeneID:395360" /db_xref="CGNC:2470" /translation="
MWRGREVPPRAAAHRPPPAIQFPEESPEPRFDESDVPAELRVANGSQKFVNFTSTIQNQLLLVSLLEHLCHMYTHNPVHSRCLFRILRQAFTRTGLLSPFAFCDEFSTVRLQHNRAITELMKAANRQVLNGELDNGDSRAIGEKEVLLEAQTSRYLNEFDEIARLGKGGYGQVYKVRNKLDGQFYAIKKINIKKATRRDCMKVLREVKVLAGLQHPNIVGYHTAWMEHVQTACPKDKTVLKLQSLPLEQESGDDHCHIQSVESGSSIIFADLTSQEEKSGDSTRLRNPDGESVQNMDVRNDFTNSNSKEICMKPNRCELPIELQEDSDSSVDCRSTDLKHDSSYDPPCSLDLDASAGSKSCTEECSGNDVALCGEFEVEYRLMLYIQMQLCELSLWDWIAARNKRCNERTEDAAGLYHLVDVSWTMKIFEELLEGVCYIHSMGVMHRDIKPRNIFLHGSDHQVKIGDFGLACKDLLWDDADQWFHTERINGLTHTSGVGTCLYASPEQLQGSDYDFKSDMYSLGVILLELFQPFGTEMERAEVITNLRNGHIPHNFCKKWPVQAKYVKLLTSQVSTERPTAAQLRESELFHTTEHQKVREQEEEIEKLKEKLRLLSTGQDEHMKQGSPV"
misc_feature 510..1820 /gene="EIF2AK1" /note="Catalytic domain of the Serine/Threonine kinase, eukaryotic translation Initiation Factor 2-Alpha Kinase 2 or Heme-Regulated Inhibitor kinase; Region: STKc_EIF2AK1_HRI; cd14049" /db_xref="CDD:270951" misc_feature order(510..518,525..530,666..671,678..683,687..692, 714..740,744..746,1206..1208,1368..1370,1377..1385) /gene="EIF2AK1" /note="dimer interface [polypeptide binding]; other site" /db_xref="CDD:270951" misc_feature 528..>1097 /gene="EIF2AK1" /note="Protein Kinases, catalytic domain; Region: PKc_like; cl21453" /db_xref="CDD:451246" misc_feature order(549..554,567..569,573..575,612..614,618..620, 1218..1229,1236..1238,1410..1415,1419..1421,1455..1457, 1554..1562,1653..1655,1659..1682) /gene="EIF2AK1" /note="active site" /db_xref="CDD:270951" misc_feature order(549..554,567..569,573..575,612..614,618..620, 711..713,1218..1229,1236..1238,1398..1400,1404..1406, 1410..1415,1419..1421,1455..1457) /gene="EIF2AK1" /note="ATP binding site [chemical binding]; other site" /db_xref="CDD:270951" misc_feature order(549..560,567..569,573..575,612..614,618..620, 711..713,834..836,837..839,945..947,954..956,960..962, 1062..1067) /gene="EIF2AK1" /note="ATP binding site [chemical binding]; other site" /db_xref="CDD:270870" misc_feature order(1452..1481,1527..1562) /gene="EIF2AK1" /note="activation loop (A-loop); other site" /db_xref="CDD:270951" misc_feature order(1554..1562,1653..1655,1659..1682) /gene="EIF2AK1" /note="eIF2alpha (substrate) binding site [polypeptide binding]; other site" /db_xref="CDD:270951" polyA_site 2021 /gene="EIF2AK1" /experiment="COORDINATES: polyA evidence [ECO:0006239]" ORIGIN
gtacagaggcgggcaggtgccggcggcgggggaaggccgcgagcgcagcgccgggcatgtggcggggtcgggaggtgccccccagggccgcggcccatcgcccgccgcccgccatccaattccctgaggagagcccggagccgcgcttcgacgagtcggacgtgccggcagaactgcgagtggccaatgggtcacagaagtttgtgaatttcacttcgaccatccagaaccagctgctgctggtgtcgctgctggagcacctgtgccacatgtacacacacaaccccgtgcactcgaggtgcttgttccgaatacttcgacaggctttcacgagaacaggtttgctctccccttttgccttctgtgatgaatttagtactgtaagactgcagcataatagagccattactgagctaatgaaagcagctaaccgacaagtgcttaatggggagcttgataatggagattctcgtgcaattggggaaaaagaagttctcttggaagcacagacatcacgatacttgaatgaatttgatgagattgcaagattaggaaaaggaggatatggccaagtatacaaggtcagaaacaagttagatggtcagttctatgctattaaaaaaatcaatattaagaaggctacaagaagagattgcatgaaggtgctacgagaggttaaagtgctggctggactgcagcatcctaatattgtgggctatcacactgcttggatggaacacgttcaaacagcttgcccaaaggataagacagtattgaagttgcagtcattacccttggaacaggagagtggagatgatcactgtcacattcagagtgtggaaagtggtagttcaattatttttgctgaccttacttcacaagaagaaaagtctggtgacagtacacgtcttagaaatccagatggtgaatcggtgcagaatatggatgtaaggaatgatttcactaacagcaatagtaaggaaatatgtatgaaaccaaatagatgtgaattacccatagaactacaagaagactctgacagtagtgttgactgtagatcaactgatttaaaacatgattcatcgtacgacccaccctgtagtctggatctagatgctagtgctggaagcaagtcctgcaccgaagagtgctctgggaatgatgtagctctctgtggagagtttgaggtggagtatcgtttgatgctttatatacagatgcaactgtgtgaactgtccctgtgggactggattgctgcccgtaacaaaagatgcaatgagagaacagaggatgctgctggtctgtaccaccttgtggatgtcagctggacaatgaaaatttttgaagagttattagaaggagtgtgctatatccacagcatgggagtgatgcatcgagacattaaacccagaaatatctttttgcatggatcagatcatcaagttaaaataggagattttggattagcctgcaaagacctcctttgggatgatgcagaccagtggtttcacacagaaaggataaatggactgacacatacctcaggtgtggggacttgcctgtatgcttcaccagaacagctgcaggggtctgactacgacttcaagtcagacatgtacagcttgggtgttatcctgctagaactcttccagccatttggaacagaaatggaaagagcagaagttataacaaatttaaggaatggccacattcctcataacttctgcaagaaatggcctgttcaagccaagtatgtaaaacttctcaccagtcaggtatccacagaaagaccaactgctgctcaacttcgtgaaagtgagctgtttcataccacagaacatcaaaaggtgagagagcaagaagaagaaatagaaaaactgaaagagaaactaagactgctttctactggacaagatgaacatatgaaacaaggttctccggtttaagtacaggaagaacacaactattgtatattaagttatagaaaacagggtttttttacataaaaatagttcagtgca
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]