GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2024-05-14 18:49:04, GGRNA.v2 : RefSeq release 222 (Jan, 2024)

LOCUS       NM_173232                702 bp    mRNA    linear   VRT 08-OCT-2023
DEFINITION  Danio rerio ribosomal protein S5 (rps5), mRNA.
ACCESSION   NM_173232
VERSION     NM_173232.1
KEYWORDS    RefSeq.
SOURCE      Danio rerio (zebrafish)
  ORGANISM  Danio rerio
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Actinopterygii; Neopterygii; Teleostei; Ostariophysi;
            Cypriniformes; Danionidae; Danioninae; Danio.
REFERENCE   1  (bases 1 to 702)
  AUTHORS   Honkoop H, de Bakker DE, Aharonov A, Kruse F, Shakked A, Nguyen PD,
            de Heus C, Garric L, Muraro MJ, Shoffner A, Tessadori F, Peterson
            JC, Noort W, Bertozzi A, Weidinger G, Posthuma G, Grun D, van der
            Laarse WJ, Klumperman J, Jaspers RT, Poss KD, van Oudenaarden A,
            Tzahor E and Bakkers J.
  TITLE     Single-cell analysis uncovers that metabolic reprogramming by ErbB2
            signaling is essential for cardiomyocyte proliferation in the
            regenerating heart
  JOURNAL   Elife 8, e50163 (2019)
   PUBMED   31868166
  REMARK    Publication Status: Online-Only
REFERENCE   2  (bases 1 to 702)
  AUTHORS   Cheung CT, Nguyen TV, Le Cam A, Patinote A, Journot L, Reynes C and
            Bobe J.
  TITLE     What makes a bad egg? Egg transcriptome reveals dysregulation of
            translational machinery and novel fertility genes important for
            fertilization
  JOURNAL   BMC Genomics 20 (1), 584 (2019)
   PUBMED   31307377
  REMARK    Publication Status: Online-Only
REFERENCE   3  (bases 1 to 702)
  AUTHORS   Bayes A, Collins MO, Reig-Viader R, Gou G, Goulding D, Izquierdo A,
            Choudhary JS, Emes RD and Grant SG.
  TITLE     Evolution of complexity in the zebrafish synapse proteome
  JOURNAL   Nat Commun 8, 14613 (2017)
   PUBMED   28252024
  REMARK    Publication Status: Online-Only
REFERENCE   4  (bases 1 to 702)
  AUTHORS   Pasquier J, Cabau C, Nguyen T, Jouanno E, Severac D, Braasch I,
            Journot L, Pontarotti P, Klopp C, Postlethwait JH, Guiguen Y and
            Bobe J.
  TITLE     Gene evolution and gene expression after whole genome duplication
            in fish: the PhyloFish database
  JOURNAL   BMC Genomics 17, 368 (2016)
   PUBMED   27189481
  REMARK    Publication Status: Online-Only
REFERENCE   5  (bases 1 to 702)
  AUTHORS   Elkon R, Milon B, Morrison L, Shah M, Vijayakumar S, Racherla M,
            Leitch CC, Silipino L, Hadi S, Weiss-Gayet M, Barras E, Schmid CD,
            Ait-Lounis A, Barnes A, Song Y, Eisenman DJ, Eliyahu E, Frolenkov
            GI, Strome SE, Durand B, Zaghloul NA, Jones SM, Reith W and
            Hertzano R.
  TITLE     RFX transcription factors are essential for hearing in mice
  JOURNAL   Nat Commun 6, 8549 (2015)
   PUBMED   26469318
  REMARK    Publication Status: Online-Only
REFERENCE   6  (bases 1 to 702)
  AUTHORS   Aanes H, Winata C, Moen LF, Ostrup O, Mathavan S, Collas P, Rognes
            T and Alestrom P.
  TITLE     Normalization of RNA-sequencing data from samples with varying mRNA
            levels
  JOURNAL   PLoS One 9 (2), e89158 (2014)
   PUBMED   24586560
  REMARK    Publication Status: Online-Only
REFERENCE   7  (bases 1 to 702)
  AUTHORS   Lai K, Amsterdam A, Farrington S, Bronson RT, Hopkins N and Lees
            JA.
  TITLE     Many ribosomal protein mutations are associated with growth
            impairment and tumor predisposition in zebrafish
  JOURNAL   Dev Dyn 238 (1), 76-85 (2009)
   PUBMED   19097187
REFERENCE   8  (bases 1 to 702)
  AUTHORS   MacInnes AW, Amsterdam A, Whittaker CA, Hopkins N and Lees JA.
  TITLE     Loss of p53 synthesis in zebrafish tumors with ribosomal protein
            gene mutations
  JOURNAL   Proc Natl Acad Sci U S A 105 (30), 10408-10413 (2008)
   PUBMED   18641120
REFERENCE   9  (bases 1 to 702)
  AUTHORS   Linney E, Dobbs-McAuliffe B, Sajadi H and Malek RL.
  TITLE     Microarray gene expression profiling during the segmentation phase
            of zebrafish development
  JOURNAL   Comp Biochem Physiol C Toxicol Pharmacol 138 (3), 351-362 (2004)
   PUBMED   15533793
COMMENT     PROVISIONAL REFSEQ: This record has not yet been subject to final
            NCBI review. The reference sequence was derived from AF506223.1.
            
            ##Evidence-Data-START##
            Transcript exon combination :: AF506223.1, CT639061.2 [ECO:0000332]
            RNAseq introns              :: single sample supports all introns
                                           SAMEA3505370, SAMEA3505371
                                           [ECO:0000348]
            ##Evidence-Data-END##
FEATURES             Location/Qualifiers
     source          1..702
                     /organism="Danio rerio"
                     /mol_type="mRNA"
                     /db_xref="taxon:7955"
                     /chromosome="15"
                     /map="15"
     gene            1..702
                     /gene="rps5"
                     /gene_synonym="chunp6933; fc74e05; fj57h03; wu:fc74e05;
                     wu:fj57h03"
                     /note="ribosomal protein S5"
                     /db_xref="GeneID:192297"
                     /db_xref="ZFIN:ZDB-GENE-020419-12"
     exon            1..33
                     /gene="rps5"
                     /gene_synonym="chunp6933; fc74e05; fj57h03; wu:fc74e05;
                     wu:fj57h03"
                     /inference="alignment:Splign:2.1.0"
     CDS             34..648
                     /gene="rps5"
                     /gene_synonym="chunp6933; fc74e05; fj57h03; wu:fc74e05;
                     wu:fj57h03"
                     /codon_start=1
                     /product="40S ribosomal protein S5"
                     /protein_id="NP_775339.1"
                     /db_xref="GeneID:192297"
                     /db_xref="ZFIN:ZDB-GENE-020419-12"
                     /translation="
MAEDWEAAPAVAETPEIKLFGKWSTDDVQINDISLQDYIAVKEKYAKYLPHSSGRYAAKRFRKAQCPIVERVTNSMMMHGRNNGKKLLTVRIVKHAFEIIHLLTGENPLQILVNAIINSGPREDSTRIGRAGTVRRQAVDVSPLRRVNQAIWLLCTGAREAAFRNIKTIAECLADELINAAKGSYNSYAIKKKDELERVAKSNR"
     misc_feature    85..645
                     /gene="rps5"
                     /gene_synonym="chunp6933; fc74e05; fj57h03; wu:fc74e05;
                     wu:fj57h03"
                     /note="Eukaryota homolog of Ribosomal Protein S7; Region:
                     uS7_Eukaryote; cd14867"
                     /db_xref="CDD:271246"
     misc_feature    order(85..87,172..180,184..195,292..294,304..306)
                     /gene="rps5"
                     /gene_synonym="chunp6933; fc74e05; fj57h03; wu:fc74e05;
                     wu:fj57h03"
                     /note="S9 interface [polypeptide binding]; other site"
                     /db_xref="CDD:271246"
     misc_feature    order(184..186,190..192,202..213,220..222,244..246,
                     253..255,259..273,283..297,304..306,424..432,436..438,
                     466..468,487..489,508..510,517..519,535..540)
                     /gene="rps5"
                     /gene_synonym="chunp6933; fc74e05; fj57h03; wu:fc74e05;
                     wu:fj57h03"
                     /note="rRNA binding site [nucleotide binding]; other site"
                     /db_xref="CDD:271246"
     misc_feature    order(316..318,325..330,337..339,535..537,541..546)
                     /gene="rps5"
                     /gene_synonym="chunp6933; fc74e05; fj57h03; wu:fc74e05;
                     wu:fj57h03"
                     /note="S25 interface [polypeptide binding]; other site"
                     /db_xref="CDD:271246"
     misc_feature    order(421..423,430..432,436..438,643..645)
                     /gene="rps5"
                     /gene_synonym="chunp6933; fc74e05; fj57h03; wu:fc74e05;
                     wu:fj57h03"
                     /note="S11 interface [polypeptide binding]; other site"
                     /db_xref="CDD:271246"
     exon            34..141
                     /gene="rps5"
                     /gene_synonym="chunp6933; fc74e05; fj57h03; wu:fc74e05;
                     wu:fj57h03"
                     /inference="alignment:Splign:2.1.0"
     exon            142..351
                     /gene="rps5"
                     /gene_synonym="chunp6933; fc74e05; fj57h03; wu:fc74e05;
                     wu:fj57h03"
                     /inference="alignment:Splign:2.1.0"
     exon            352..480
                     /gene="rps5"
                     /gene_synonym="chunp6933; fc74e05; fj57h03; wu:fc74e05;
                     wu:fj57h03"
                     /inference="alignment:Splign:2.1.0"
     exon            481..579
                     /gene="rps5"
                     /gene_synonym="chunp6933; fc74e05; fj57h03; wu:fc74e05;
                     wu:fj57h03"
                     /inference="alignment:Splign:2.1.0"
     exon            580..700
                     /gene="rps5"
                     /gene_synonym="chunp6933; fc74e05; fj57h03; wu:fc74e05;
                     wu:fj57h03"
                     /inference="alignment:Splign:2.1.0"
ORIGIN      
ctcgagtgcgccattcacacacacgctgcgaagatggctgaagattgggaggctgcaccagctgttgctgaaaccccagagatcaaactctttggcaagtggagcacagatgatgtacagatcaatgacatctccctgcaggattacattgccgtgaaggagaaatacgccaaatacctccctcattccagcggcagatacgcagccaagcgtttccgtaaggctcagtgtcccattgtggagcgcgtcactaactccatgatgatgcacggacgcaacaacggcaagaaactgctgaccgttcgcatcgtcaagcacgcttttgagatcatccacctgctcactggcgagaatcctctgcagattctggtaaacgccatcatcaacagtggccctcgtgaggactccacccgtatcggacgtgctggaaccgtgaggagacaggctgttgatgtgtcccccctgcgcagagtcaaccaggccatctggctgctctgcactggtgcaagagaagctgctttcaggaacatcaagaccatcgcagagtgtcttgctgacgagctcatcaacgctgccaagggttcctacaactcttacgccatcaagaagaaagatgagctggagagagtggccaagtctaaccgctaatctccattttgtataaaatcggattacattaaaagaggaagagttaaacctaaa
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]