GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2024-05-15 14:06:50, GGRNA.v2 : RefSeq release 222 (Jan, 2024)

LOCUS       NM_131155               1760 bp    mRNA    linear   VRT 15-MAY-2023
DEFINITION  Danio rerio homeobox A10b (hoxa10b), mRNA.
ACCESSION   NM_131155
VERSION     NM_131155.2
KEYWORDS    RefSeq.
SOURCE      Danio rerio (zebrafish)
  ORGANISM  Danio rerio
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Actinopterygii; Neopterygii; Teleostei; Ostariophysi;
            Cypriniformes; Danionidae; Danioninae; Danio.
REFERENCE   1  (bases 1 to 1760)
  AUTHORS   Banu S, Gaur N, Nair S, Ravikrishnan T, Khan S, Mani S, Bharathi S,
            Mandal K, Kuram NA, Vuppaladadium S, Ravi R, Murthy CLN, Quoseena
            M, Babu NS and Idris MM.
  TITLE     Understanding the complexity of epimorphic regeneration in
            zebrafish caudal fin tissue: A transcriptomic and proteomic
            approach
  JOURNAL   Genomics 114 (2), 110300 (2022)
   PUBMED   35134499
REFERENCE   2  (bases 1 to 1760)
  AUTHORS   Yamada K, Maeno A, Araki S, Kikuchi M, Suzuki M, Ishizaka M, Satoh
            K, Akama K, Kawabe Y, Suzuki K, Kobayashi D, Hamano N and Kawamura
            A.
  TITLE     An atlas of seven zebrafish hox cluster mutants provides insights
            into sub/neofunctionalization of vertebrate Hox clusters
  JOURNAL   Development 148 (11) (2021)
   PUBMED   34096572
REFERENCE   3  (bases 1 to 1760)
  AUTHORS   Smeeton J, Natarajan N, Naveen Kumar A, Miyashita T, Baddam P,
            Fabian P, Graf D and Crump JG.
  TITLE     Zebrafish model for spondylo-megaepiphyseal-metaphyseal dysplasia
            reveals post-embryonic roles of Nkx3.2 in the skeleton
  JOURNAL   Development 148 (2) (2021)
   PUBMED   33462117
  REMARK    Publication Status: Online-Only
REFERENCE   4  (bases 1 to 1760)
  AUTHORS   Messina A, Pulli K, Santini S, Acierno J, Kansakoski J, Cassatella
            D, Xu C, Casoni F, Malone SA, Ternier G, Conte D, Sidis Y, Tommiska
            J, Vaaralahti K, Dwyer A, Gothilf Y, Merlo GR, Santoni F,
            Niederlander NJ, Giacobini P, Raivio T and Pitteloud N.
  TITLE     Neuron-Derived Neurotrophic Factor Is Mutated in Congenital
            Hypogonadotropic Hypogonadism
  JOURNAL   Am J Hum Genet 106 (1), 58-70 (2020)
   PUBMED   31883645
REFERENCE   5  (bases 1 to 1760)
  AUTHORS   Zuccarini G, D'Atri I, Cottone E, Mackie K, Shainer I, Gothilf Y,
            Provero P, Bovolin P and Merlo GR.
  TITLE     Interference with the Cannabinoid Receptor CB1R Results in
            Miswiring of GnRH3 and AgRP1 Axons in Zebrafish Embryos
  JOURNAL   Int J Mol Sci 21 (1), 168 (2019)
   PUBMED   31881740
  REMARK    Publication Status: Online-Only
REFERENCE   6  (bases 1 to 1760)
  AUTHORS   Yekta S, Shih IH and Bartel DP.
  TITLE     MicroRNA-directed cleavage of HOXB8 mRNA
  JOURNAL   Science 304 (5670), 594-596 (2004)
   PUBMED   15105502
REFERENCE   7  (bases 1 to 1760)
  AUTHORS   Chiu CH, Dewar K, Wagner GP, Takahashi K, Ruddle F, Ledje C,
            Bartsch P, Scemama JL, Stellwag E, Fried C, Prohaska SJ, Stadler PF
            and Amemiya CT.
  TITLE     Bichir HoxA cluster sequence reveals surprising trends in
            ray-finned fish genomic evolution
  JOURNAL   Genome Res 14 (1), 11-17 (2004)
   PUBMED   14707166
REFERENCE   8  (bases 1 to 1760)
  AUTHORS   Chiu CH, Amemiya C, Dewar K, Kim CB, Ruddle FH and Wagner GP.
  TITLE     Molecular evolution of the HoxA cluster in the three major
            gnathostome lineages
  JOURNAL   Proc Natl Acad Sci U S A 99 (8), 5492-5497 (2002)
   PUBMED   11943847
REFERENCE   9  (bases 1 to 1760)
  AUTHORS   Feldman B, Dougan ST, Schier AF and Talbot WS.
  TITLE     Nodal-related signals establish mesendodermal fate and trunk neural
            identity in zebrafish
  JOURNAL   Curr Biol 10 (9), 531-534 (2000)
   PUBMED   10801442
REFERENCE   10 (bases 1 to 1760)
  AUTHORS   Snell EA, Scemama JL and Stellwag EJ.
  TITLE     Genomic organization of the Hoxa4-Hoxa10 region from Morone
            saxatilis: implications for Hox gene evolution among vertebrates
  JOURNAL   J Exp Zool 285 (1), 41-49 (1999)
   PUBMED   10327649
COMMENT     VALIDATED REFSEQ: This record has undergone validation or
            preliminary review. The reference sequence was derived from
            CR392024.15.
            
            On Apr 17, 2018 this sequence version replaced NM_131155.1.
            
            Sequence Note: The RefSeq transcript and protein were derived from
            genomic sequence to make the sequence consistent with the reference
            genome assembly. The genomic coordinates used for the transcript
            record were based on alignments.
            
            Publication Note:  This RefSeq record includes a subset of the
            publications that are available for this gene. Please see the Gene
            record to access additional publications.
            
            ##Evidence-Data-START##
            Transcript exon combination :: GDQH01030876.1, GFIL01012784.1
                                           [ECO:0000332]
            RNAseq introns              :: single sample supports all introns
                                           SAMEA3505370, SAMEA3505371
                                           [ECO:0000348]
            ##Evidence-Data-END##
            COMPLETENESS: complete on the 3' end.
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-864               CR392024.15        72246-73109         c
            865-1760            CR392024.15        70181-71076         c
FEATURES             Location/Qualifiers
     source          1..1760
                     /organism="Danio rerio"
                     /mol_type="mRNA"
                     /strain="Tuebingen"
                     /db_xref="taxon:7955"
                     /chromosome="16"
                     /map="16"
     gene            1..1760
                     /gene="hoxa10b"
                     /gene_synonym="Hoxa-10; hoxa10; z-140"
                     /note="homeobox A10b"
                     /db_xref="GeneID:30391"
                     /db_xref="ZFIN:ZDB-GENE-990415-97"
     exon            1..864
                     /gene="hoxa10b"
                     /gene_synonym="Hoxa-10; hoxa10; z-140"
                     /inference="alignment:Splign:2.1.0"
     misc_feature    69..71
                     /gene="hoxa10b"
                     /gene_synonym="Hoxa-10; hoxa10; z-140"
                     /note="upstream in-frame stop codon"
     CDS             99..1142
                     /gene="hoxa10b"
                     /gene_synonym="Hoxa-10; hoxa10; z-140"
                     /note="hox-A10; homeobox gene A-10; homeo box A10b"
                     /codon_start=1
                     /product="homeobox protein Hox-A10b"
                     /protein_id="NP_571230.2"
                     /db_xref="GeneID:30391"
                     /db_xref="ZFIN:ZDB-GENE-990415-97"
                     /translation="
MSSRKGNLLPPSNYTTKMSCSDSPSGNSFLVDSLIHGRSEGSGHYYQNSGVYLQPTSEYSYGLSNCGYFSGLKRNESNSQNVVPTCGPYQGMETWLETSRSCRIEQPNNQITPRSFSPTIKEENSYCLYESEKCPKETITEDISYSRLTPNSCPSSNNNGCVPVPGYFRLSQTCTTSKGFTDNQTIPTHVVAQRSTRFDSSLSAIAAEASRDESDEPPTCAPCAPGRNKELRGSTGTASSPEPPDSPEKAVTVTKAGDSKSESTANWLTAKSGRKKRCPYTKHQTLELEKEFLFNMYLTRERRLEISRSVHLTDRQVKIWFQNRRMKLKKMSRENRIRELSANFSFS"
     misc_feature    order(918..932,936..938,987..989,1005..1007,1044..1046,
                     1050..1055,1062..1067,1071..1079,1083..1088)
                     /gene="hoxa10b"
                     /gene_synonym="Hoxa-10; hoxa10; z-140"
                     /note="DNA binding site [nucleotide binding]"
                     /db_xref="CDD:238039"
     misc_feature    924..1085
                     /gene="hoxa10b"
                     /gene_synonym="Hoxa-10; hoxa10; z-140"
                     /note="Homeobox domain; Region: Homeobox; pfam00046"
                     /db_xref="CDD:425441"
     misc_feature    order(924..926,933..935,1053..1055,1062..1067,1074..1076)
                     /gene="hoxa10b"
                     /gene_synonym="Hoxa-10; hoxa10; z-140"
                     /note="specific DNA base contacts [nucleotide binding];
                     other site"
                     /db_xref="CDD:238039"
     exon            865..1760
                     /gene="hoxa10b"
                     /gene_synonym="Hoxa-10; hoxa10; z-140"
                     /inference="alignment:Splign:2.1.0"
ORIGIN      
ggaggagtcatcggtgctcgttgcgatttaattggctgttagctcacactgagttgtatagttatcagtaattatattcagaatgttttgcacaagaaatgtcatccagaaagggcaatcttcttccaccgtcaaattataccacaaagatgtcatgctccgatagtccatctggaaattcgtttttggtagattctttgatccacggaaggtccgagggaagtggacactactaccaaaacagcggagtttacttgcagccgacctccgaatattcttatggactgtctaactgtggctatttttcgggactcaagcggaacgagagcaactcgcaaaatgtagtacctacatgtggtccatatcaaggcatggaaacatggttggagacgtcgaggtcctgtcgcattgaacagcctaacaaccaaattaccccacggtcgttctcgcccaccataaaagaggaaaactcttactgcttatatgagtctgagaagtgcccaaaagaaaccattacagaggatatatcgtactcgcggctgacaccaaactcatgtccatctagcaacaataacggctgtgttccggtgcccggttacttccgtctgtctcagacatgcaccacatctaagggttttacagacaaccagactataccgactcatgtagtggctcaacgttcaactcgatttgacagctctctttcagctatagcagccgaagcaagccgggacgagagcgacgagccccccacatgcgcaccatgtgccccgggaagaaacaaggagctaagggggtccactggcaccgcttcatctccagaaccaccggacagcccggagaaggcggtcactgtaactaaagcaggagattccaaaagtgagagtacagctaactggctgacggcgaagagtggccgcaagaagcgttgcccttacaccaaacatcagacattagagctggagaaggagtttctcttcaacatgtacttgacacgagaacgtcgcctcgagattagccgcagtgttcacctcacagacagacaagtcaaaatatggtttcaaaaccgacggatgaagctgaagaagatgagtagagaaaaccgaatccgcgagttgtcagccaacttcagtttttcatgaagcgtctagctttatagatctctggcgccctcctccatcagctgcagtggtagtctacttgcatccaaccgtctacgtagatgtgtgcatatatgacttgtgcaagatactattgataacttattgtgtgtcgtatactgttgacgtttttatatgtttatgtataattttatttgacaacccagtcgtcataacatgtcatggttatttataaactgtcaagagcacttcactgtaaagcaagagaggaaaatatcgaatgctaaaggtgttcattgtacatagcattctgattatattgtacatttattgtatataaatgcgatatttgcatgttgtaataataactattatgaatcgatttttaaataataacgtttgtttataagtacgaccttgtcatgtatttgctgttctgggcataattggaggagtccaattctttaaaatgtagaaatgtgtataattgcagacacgacggaattcctgtattagactattaccagcatccaaatgtaccatctttctggaaatacaggccgagaagatggactcgggtgtaaaataaatatacgtgacagaaaataaataaaggcatgtacatgaaaatcatcataa
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]