2024-05-15 17:41:56, GGRNA.v2 : RefSeq release 222 (Jan, 2024)
LOCUS NM_131144 1020 bp mRNA linear VRT 13-MAY-2023 DEFINITION Danio rerio homeobox C5a (hoxc5a), mRNA. ACCESSION NM_131144 VERSION NM_131144.2 KEYWORDS RefSeq. SOURCE Danio rerio (zebrafish) ORGANISM Danio rerio Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Actinopterygii; Neopterygii; Teleostei; Ostariophysi; Cypriniformes; Danionidae; Danioninae; Danio. REFERENCE 1 (bases 1 to 1020) AUTHORS Banu S, Gaur N, Nair S, Ravikrishnan T, Khan S, Mani S, Bharathi S, Mandal K, Kuram NA, Vuppaladadium S, Ravi R, Murthy CLN, Quoseena M, Babu NS and Idris MM. TITLE Understanding the complexity of epimorphic regeneration in zebrafish caudal fin tissue: A transcriptomic and proteomic approach JOURNAL Genomics 114 (2), 110300 (2022) PUBMED 35134499 REFERENCE 2 (bases 1 to 1020) AUTHORS Yamada K, Maeno A, Araki S, Kikuchi M, Suzuki M, Ishizaka M, Satoh K, Akama K, Kawabe Y, Suzuki K, Kobayashi D, Hamano N and Kawamura A. TITLE An atlas of seven zebrafish hox cluster mutants provides insights into sub/neofunctionalization of vertebrate Hox clusters JOURNAL Development 148 (11) (2021) PUBMED 34096572 REFERENCE 3 (bases 1 to 1020) AUTHORS Pillay S, Takahashi H, Carninci P and Kanhere A. TITLE Antisense RNAs during early vertebrate development are divided in groups with distinct features JOURNAL Genome Res 31 (6), 995-1010 (2021) PUBMED 33795334 REFERENCE 4 (bases 1 to 1020) AUTHORS Malmstrom M, Britz R, Matschiner M, Torresen OK, Hadiaty RK, Yaakob N, Tan HH, Jakobsen KS, Salzburger W and Ruber L. TITLE The Most Developmentally Truncated Fishes Show Extensive Hox Gene Loss and Miniaturized Genomes JOURNAL Genome Biol Evol 10 (4), 1088-1103 (2018) PUBMED 29684203 REFERENCE 5 (bases 1 to 1020) AUTHORS Barsh GR, Isabella AJ and Moens CB. TITLE Vagus Motor Neuron Topographic Map Determined by Parallel Mechanisms of hox5 Expression and Time of Axon Initiation JOURNAL Curr Biol 27 (24), 3812-3825 (2017) PUBMED 29225029 REFERENCE 6 (bases 1 to 1020) AUTHORS Snell EA, Scemama JL and Stellwag EJ. TITLE Genomic organization of the Hoxa4-Hoxa10 region from Morone saxatilis: implications for Hox gene evolution among vertebrates JOURNAL J Exp Zool 285 (1), 41-49 (1999) PUBMED 10327649 REFERENCE 7 (bases 1 to 1020) AUTHORS Gates MA, Kim L, Egan ES, Cardozo T, Sirotkin HI, Dougan ST, Lashkari D, Abagyan R, Schier AF and Talbot WS. TITLE A genetic linkage map for zebrafish: comparative analysis and localization of genes and expressed sequences JOURNAL Genome Res 9 (4), 334-347 (1999) PUBMED 10207156 REFERENCE 8 (bases 1 to 1020) AUTHORS Prince VE, Joly L, Ekker M and Ho RK. TITLE Zebrafish hox genes: genomic organization and modified colinear expression patterns in the trunk JOURNAL Development 125 (3), 407-420 (1998) PUBMED 9425136 REFERENCE 9 (bases 1 to 1020) AUTHORS Ekker M, Speevak MD, Martin CC, Joly L, Giroux G and Chevrette M. TITLE Stable transfer of zebrafish chromosome segments into mouse cells JOURNAL Genomics 33 (1), 57-64 (1996) PUBMED 8617510 REFERENCE 10 (bases 1 to 1020) AUTHORS Geada AM, Coletta PL and Sharpe PT. TITLE Characterization of the murine Hoxc-5 gene JOURNAL Mamm Genome 7 (1), 81-84 (1996) PUBMED 8903739 COMMENT VALIDATED REFSEQ: This record has undergone validation or preliminary review. The reference sequence was derived from BX005254.9. On Aug 27, 2015 this sequence version replaced NM_131144.1. Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## Transcript exon combination :: BC163205.1, GFIL01012817.1 [ECO:0000332] RNAseq introns :: single sample supports all introns SAMEA3505370, SAMEA3505371 [ECO:0000348] ##Evidence-Data-END## PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP 1-551 BX005254.9 94968-95518 c 552-1020 BX005254.9 93681-94149 c FEATURES Location/Qualifiers source 1..1020 /organism="Danio rerio" /mol_type="mRNA" /strain="Tuebingen" /db_xref="taxon:7955" /chromosome="23" /map="23" gene 1..1020 /gene="hoxc5a" /gene_synonym="hox-3.4; hoxc5; z-142; ZF-25" /note="homeobox C5a" /db_xref="GeneID:30379" /db_xref="ZFIN:ZDB-GENE-980526-533" exon 1..551 /gene="hoxc5a" /gene_synonym="hox-3.4; hoxc5; z-142; ZF-25" /inference="alignment:Splign:2.1.0" misc_feature 44..46 /gene="hoxc5a" /gene_synonym="hox-3.4; hoxc5; z-142; ZF-25" /note="upstream in-frame stop codon" CDS 65..766 /gene="hoxc5a" /gene_synonym="hox-3.4; hoxc5; z-142; ZF-25" /note="homeobox gene C-5; homeo box C5a" /codon_start=1 /product="homeobox protein Hox-C5a" /protein_id="NP_571219.2" /db_xref="GeneID:30379" /db_xref="ZFIN:ZDB-GENE-980526-533" /translation="
MSSYVGKSFSKQTQDASSCRMHTFDNYGAHSEFHESNYAYEGLDLGGSFSSQIPTNSLRREAINTTDRARSSAAVQRTQSCSALGSRSFVSTHGYNPLSHGLLSQKAEGNMEVMEKPSGKSRTDDIKMETTSAIKQQTNSTQRQNQSQPQIYPWMTKLHMSHESDGKRSRTSYTRYQTLELEKEFHFNRYLTRRRRIEIANNLCLNERQIKIWFQNRRMKWKKDSKLKVKGGL"
misc_feature order(563..577,581..583,632..634,650..652,689..691, 695..700,707..712,716..724,728..733) /gene="hoxc5a" /gene_synonym="hox-3.4; hoxc5; z-142; ZF-25" /note="DNA binding site [nucleotide binding]" /db_xref="CDD:238039" misc_feature 569..730 /gene="hoxc5a" /gene_synonym="hox-3.4; hoxc5; z-142; ZF-25" /note="Homeobox domain; Region: Homeobox; pfam00046" /db_xref="CDD:425441" misc_feature order(569..571,578..580,698..700,707..712,719..721) /gene="hoxc5a" /gene_synonym="hox-3.4; hoxc5; z-142; ZF-25" /note="specific DNA base contacts [nucleotide binding]; other site" /db_xref="CDD:238039" exon 552..1020 /gene="hoxc5a" /gene_synonym="hox-3.4; hoxc5; z-142; ZF-25" /inference="alignment:Splign:2.1.0" ORIGIN
cgtttctgcagtgaccgagtgttatttgtgagtctctttagggtgatattgtttgggaaatagcatgagctcatacgttgggaagtctttttctaagcagacgcaagacgcctcctcttgtagaatgcacacttttgacaactatggagctcacagtgagttccacgagtccaattacgcgtacgaagggcttgatctcggcggatccttcagttctcaaatccccaccaactctttgaggcgggaggcgataaacacaaccgaccgtgcaaggagcagtgcagcagttcagcgaacacagtcttgttcagctctgggctctcgtagctttgtaagcactcacgggtacaaccccctcagtcacggactgttgagccaaaaagccgaggggaatatggaagttatggagaagcccagcggcaagagccgcacagacgatatcaaaatggagactacttcagcgataaagcaacaaactaattcgactcagcgtcagaaccagtcgcagccgcagatatatccgtggatgacaaagctacacatgagccacgaatctgacggtaaaaggtcacgaaccagttacacccggtaccagactctggagttggagaaagagttccatttcaaccgatacctcacacgtcgcagacgtattgagattgccaataacctctgcttgaacgagcgccaaattaaaatatggttccagaaccgtcgcatgaagtggaagaaggactcaaagttgaaagtaaaaggaggactataaataatgtgttgcacgacttcaattacaacagcctgaaaataaaggcaatgttaacccttgaactaaaacaacgaatgatttaaaattgattttgttattaacaactgttgatgtctatcatttgtttacaatattatgttgttatgtgaatatgttgatattttcaatatttattgatagtgctctgtccccagtacggcagatgctaatttgaataatgtatgagcttaaacattgattatgctttactaaac
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]